Incidental Mutation 'R1033:Nup205'
ID 95247
Institutional Source Beutler Lab
Gene Symbol Nup205
Ensembl Gene ENSMUSG00000038759
Gene Name nucleoporin 205
Synonyms 3830404O05Rik
MMRRC Submission 039132-MU
Accession Numbers

NCBI RefSeq: NM_027513.1; MGI:2141625
Essential gene? Probably essential (E-score: 0.962) question?
Stock # R1033 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 35177421-35247596 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 35227442 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 1421 (A1421V)
Ref Sequence ENSEMBL: ENSMUSP00000144126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043815] [ENSMUST00000170234] [ENSMUST00000201374]
AlphaFold A0A0J9YUD5
Predicted Effect probably benign
Transcript: ENSMUST00000043815
AA Change: A1368V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039656
Gene: ENSMUSG00000038759
AA Change: A1368V

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Nup192 14 1684 N/A PFAM
low complexity region 1995 2005 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170234
SMART Domains Protein: ENSMUSP00000130033
Gene: ENSMUSG00000038759

DomainStartEndE-ValueType
Pfam:DUF3414 13 322 9.7e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201374
AA Change: A1421V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144126
Gene: ENSMUSG00000038759
AA Change: A1421V

DomainStartEndE-ValueType
low complexity region 36 50 N/A INTRINSIC
Pfam:Nup192 67 1737 N/A PFAM
low complexity region 2048 2058 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201609
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201842
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleoporin, which is a subunit of the nuclear pore complex that functions in active transport of proteins, RNAs and ribonucleoprotein particles between the nucleus and cytoplasm. Mutations in this gene are associated with steroid-resistant nephrotic syndrome. [provided by RefSeq, Jul 2016]
Allele List at MGI

All alleles(32) : Targeted(2) Gene trapped(30)
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G A 1: 26,682,385 P1238L probably benign Het
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Akap6 A C 12: 53,069,222 D1036A probably damaging Het
Alg6 T C 4: 99,762,033 S497P probably benign Het
Arhgap10 T A 8: 77,257,347 I700L possibly damaging Het
Atp11a A G 8: 12,828,555 Y377C probably damaging Het
Atp2b2 A T 6: 113,793,888 probably null Het
Card14 T A 11: 119,338,370 V702D probably damaging Het
Ccdc17 C T 4: 116,596,880 R32* probably null Het
Cdh7 A T 1: 110,085,053 D372V probably damaging Het
Cfap54 A T 10: 92,839,449 I2870N probably benign Het
Cped1 G T 6: 22,016,951 V100F probably damaging Het
Dapk1 T C 13: 60,721,865 probably null Het
Exoc4 G A 6: 33,265,987 G45D probably damaging Het
Fam110b A T 4: 5,799,440 N286I probably benign Het
Fbxo10 A T 4: 45,062,236 C97S probably damaging Het
Frem3 A T 8: 80,695,157 H2062L probably benign Het
Frk T C 10: 34,608,458 C476R probably damaging Het
Gm10471 T C 5: 26,089,127 K18E probably benign Het
Gm10542 A G 18: 44,204,601 T49A probably benign Het
Gm128 A G 3: 95,240,011 V324A possibly damaging Het
Gpr141 C T 13: 19,751,710 M298I probably benign Het
Gxylt1 T C 15: 93,245,077 E369G probably benign Het
Hpse2 A G 19: 42,913,199 V368A probably benign Het
Ice1 A T 13: 70,606,594 S458T probably damaging Het
Itgb7 T A 15: 102,223,554 D198V probably damaging Het
Kcnk10 A G 12: 98,518,670 V72A possibly damaging Het
Magel2 A G 7: 62,380,050 M901V unknown Het
Mgam A T 6: 40,680,624 Y971F probably benign Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mpp6 T C 6: 50,183,736 Y326H probably damaging Het
Mug1 A T 6: 121,880,551 D1078V probably damaging Het
Myom2 G A 8: 15,108,934 R870H probably benign Het
Nek8 A T 11: 78,171,285 L71Q probably null Het
Nox4 T A 7: 87,374,413 D502E probably damaging Het
Nsmaf G A 4: 6,438,054 P73S probably damaging Het
Nxpe4 T C 9: 48,393,233 F207L probably damaging Het
Olfr1043 A G 2: 86,162,850 I33T possibly damaging Het
Olfr1282 A T 2: 111,335,802 I92N probably damaging Het
Olfr410 A C 11: 74,334,636 N198K possibly damaging Het
Olfr59 A C 11: 74,288,666 T7P probably damaging Het
Prkdc T C 16: 15,767,951 L2451P probably damaging Het
Rad51ap2 C T 12: 11,456,251 S58F probably damaging Het
Rbbp8 A G 18: 11,742,705 R892G probably benign Het
Rock1 A G 18: 10,067,535 S1333P probably benign Het
Rpl7 A G 1: 16,102,504 I197T probably benign Het
Sar1a C A 10: 61,685,616 Q81K probably damaging Het
Shank1 A T 7: 44,356,796 H1979L possibly damaging Het
Slc10a2 C T 8: 5,104,889 V99M probably damaging Het
Slc22a30 G A 19: 8,335,801 Q436* probably null Het
Szt2 C T 4: 118,387,106 R1305H probably damaging Het
Ubash3a G A 17: 31,208,212 G32S probably damaging Het
Vmn1r200 G A 13: 22,395,890 D279N probably damaging Het
Zbtb8a T C 4: 129,354,221 D419G possibly damaging Het
Other mutations in Nup205
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Nup205 APN 6 35214802 missense probably damaging 1.00
IGL01086:Nup205 APN 6 35208936 splice site probably benign
IGL01138:Nup205 APN 6 35208084 nonsense probably null
IGL01333:Nup205 APN 6 35241063 missense probably benign
IGL01399:Nup205 APN 6 35219689 missense possibly damaging 0.80
IGL01466:Nup205 APN 6 35199959 missense probably benign 0.08
IGL01913:Nup205 APN 6 35227430 missense probably benign 0.10
IGL02159:Nup205 APN 6 35189178 missense probably damaging 1.00
IGL02442:Nup205 APN 6 35190068 missense probably benign 0.01
IGL02447:Nup205 APN 6 35227576 splice site probably null
IGL02558:Nup205 APN 6 35189924 missense probably damaging 1.00
IGL03306:Nup205 APN 6 35208169 missense probably damaging 0.98
IGL03328:Nup205 APN 6 35232414 missense probably damaging 0.99
Figaro UTSW 6 35196714 splice site probably null
Marcellina UTSW 6 35183969 missense probably damaging 1.00
Spirit UTSW 6 35232408 missense probably damaging 0.98
Susanna UTSW 6 35208109 missense possibly damaging 0.94
voyager UTSW 6 35189885 missense possibly damaging 0.80
BB007:Nup205 UTSW 6 35194576 missense probably damaging 0.98
BB017:Nup205 UTSW 6 35194576 missense probably damaging 0.98
P0012:Nup205 UTSW 6 35196543 missense possibly damaging 0.90
R0102:Nup205 UTSW 6 35225780 splice site probably benign
R0102:Nup205 UTSW 6 35225780 splice site probably benign
R0362:Nup205 UTSW 6 35196714 splice site probably null
R0374:Nup205 UTSW 6 35208837 missense probably damaging 1.00
R0415:Nup205 UTSW 6 35214634 splice site probably benign
R0427:Nup205 UTSW 6 35194463 missense probably benign 0.01
R0543:Nup205 UTSW 6 35198969 missense probably benign
R0611:Nup205 UTSW 6 35225968 missense probably null 1.00
R0761:Nup205 UTSW 6 35196428 splice site probably benign
R0828:Nup205 UTSW 6 35194566 missense probably benign
R0906:Nup205 UTSW 6 35236892 missense probably damaging 1.00
R1023:Nup205 UTSW 6 35234706 missense probably damaging 0.98
R1375:Nup205 UTSW 6 35200071 splice site probably benign
R1447:Nup205 UTSW 6 35215185 missense probably benign 0.00
R1468:Nup205 UTSW 6 35225982 critical splice donor site probably null
R1468:Nup205 UTSW 6 35225982 critical splice donor site probably null
R1625:Nup205 UTSW 6 35191943 missense probably benign 0.31
R1652:Nup205 UTSW 6 35238966 missense probably benign
R1659:Nup205 UTSW 6 35234788 missense probably benign 0.02
R1693:Nup205 UTSW 6 35210971 missense probably benign 0.05
R1769:Nup205 UTSW 6 35205431 missense probably damaging 1.00
R1839:Nup205 UTSW 6 35219714 missense probably benign 0.00
R1959:Nup205 UTSW 6 35233366 missense probably benign 0.16
R2051:Nup205 UTSW 6 35230516 missense probably benign 0.29
R2267:Nup205 UTSW 6 35241349 missense possibly damaging 0.67
R2401:Nup205 UTSW 6 35208134 nonsense probably null
R3697:Nup205 UTSW 6 35188711 missense probably benign 0.15
R3938:Nup205 UTSW 6 35219742 missense probably damaging 1.00
R4074:Nup205 UTSW 6 35192040 critical splice donor site probably null
R4117:Nup205 UTSW 6 35241012 nonsense probably null
R4364:Nup205 UTSW 6 35192027 missense probably benign 0.38
R4366:Nup205 UTSW 6 35192027 missense probably benign 0.38
R4594:Nup205 UTSW 6 35196489 missense probably benign 0.00
R4706:Nup205 UTSW 6 35202008 missense probably damaging 1.00
R4787:Nup205 UTSW 6 35202061 missense probably damaging 1.00
R4849:Nup205 UTSW 6 35230570 missense possibly damaging 0.90
R4850:Nup205 UTSW 6 35230530 missense probably benign 0.16
R4943:Nup205 UTSW 6 35224639 missense probably damaging 1.00
R4966:Nup205 UTSW 6 35243849 missense probably benign 0.00
R5138:Nup205 UTSW 6 35225866 missense probably damaging 1.00
R5251:Nup205 UTSW 6 35196482 splice site probably null
R5444:Nup205 UTSW 6 35189189 missense probably damaging 0.98
R5760:Nup205 UTSW 6 35247343 missense probably damaging 1.00
R5762:Nup205 UTSW 6 35227680 missense probably damaging 1.00
R5762:Nup205 UTSW 6 35230548 missense probably damaging 0.96
R5941:Nup205 UTSW 6 35232408 missense probably damaging 0.98
R5969:Nup205 UTSW 6 35177578 unclassified probably benign
R6003:Nup205 UTSW 6 35212816 missense probably benign
R6178:Nup205 UTSW 6 35243843 missense possibly damaging 0.85
R6315:Nup205 UTSW 6 35236869 missense probably damaging 1.00
R6392:Nup205 UTSW 6 35189885 missense possibly damaging 0.80
R6710:Nup205 UTSW 6 35247373 missense probably benign 0.00
R6954:Nup205 UTSW 6 35208109 missense possibly damaging 0.94
R7022:Nup205 UTSW 6 35243936 missense probably benign 0.45
R7041:Nup205 UTSW 6 35224535 missense possibly damaging 0.49
R7052:Nup205 UTSW 6 35215142 missense possibly damaging 0.81
R7310:Nup205 UTSW 6 35225969 missense possibly damaging 0.78
R7363:Nup205 UTSW 6 35232573 missense probably benign 0.28
R7399:Nup205 UTSW 6 35214676 missense probably damaging 0.99
R7428:Nup205 UTSW 6 35227559 missense probably damaging 1.00
R7553:Nup205 UTSW 6 35201999 missense probably damaging 1.00
R7665:Nup205 UTSW 6 35177620 missense possibly damaging 0.46
R7841:Nup205 UTSW 6 35247437 missense unknown
R7930:Nup205 UTSW 6 35194576 missense probably damaging 0.98
R7973:Nup205 UTSW 6 35245339 missense probably benign
R7976:Nup205 UTSW 6 35198953 missense probably damaging 1.00
R8073:Nup205 UTSW 6 35202169 critical splice donor site probably null
R8080:Nup205 UTSW 6 35227376 missense probably damaging 1.00
R8118:Nup205 UTSW 6 35230516 missense probably benign 0.29
R8213:Nup205 UTSW 6 35225203 missense probably benign 0.26
R8237:Nup205 UTSW 6 35227503 missense possibly damaging 0.89
R8408:Nup205 UTSW 6 35225247 missense probably damaging 1.00
R8807:Nup205 UTSW 6 35183969 missense probably damaging 1.00
R8812:Nup205 UTSW 6 35214334 missense probably damaging 1.00
R9061:Nup205 UTSW 6 35219873 intron probably benign
R9261:Nup205 UTSW 6 35199857 missense probably benign 0.00
R9403:Nup205 UTSW 6 35199974 missense probably benign 0.45
R9648:Nup205 UTSW 6 35225811 missense probably benign 0.00
R9744:Nup205 UTSW 6 35232575 missense probably damaging 0.99
R9800:Nup205 UTSW 6 35186533 missense possibly damaging 0.85
Z1177:Nup205 UTSW 6 35177605 missense unknown
Z1177:Nup205 UTSW 6 35208793 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACGTGAGACTTCCTGAGTTCTGGC -3'
(R):5'- AGCTTCTAGTGTGTCCGGCTCATC -3'

Sequencing Primer
(F):5'- CCTGAGTTCTGGCGGGAG -3'
(R):5'- TGAGTCCTTACACGCTGGAAG -3'
Posted On 2014-01-05