Incidental Mutation 'R1137:Kif20b'
ID95250
Institutional Source Beutler Lab
Gene Symbol Kif20b
Ensembl Gene ENSMUSG00000024795
Gene Namekinesin family member 20B
SynonymsKif20b, Mphosph1, N-6 kinesin
MMRRC Submission 039210-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.857) question?
Stock #R1137 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location34922361-34975745 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 34937086 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087341] [ENSMUST00000223907] [ENSMUST00000225408]
Predicted Effect probably null
Transcript: ENSMUST00000087341
SMART Domains Protein: ENSMUSP00000084599
Gene: ENSMUSG00000024795

DomainStartEndE-ValueType
Blast:KISc 2 46 5e-15 BLAST
KISc 56 483 1.19e-103 SMART
low complexity region 521 551 N/A INTRINSIC
coiled coil region 565 602 N/A INTRINSIC
coiled coil region 705 746 N/A INTRINSIC
coiled coil region 823 947 N/A INTRINSIC
coiled coil region 1020 1325 N/A INTRINSIC
coiled coil region 1348 1510 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000223907
Predicted Effect probably benign
Transcript: ENSMUST00000224728
Predicted Effect probably benign
Transcript: ENSMUST00000225408
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for ENU induced mutations display craniofacial and nervous system abnormalities including exencephaly, microcephaly, decreased forebrain size and impaired neuronal progenitor proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410002F23Rik T A 7: 44,250,832 S54T probably benign Het
Ahdc1 A G 4: 133,062,113 T222A possibly damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Cep250 A G 2: 155,990,840 K1561E probably benign Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Clca4a A G 3: 144,970,685 V78A probably damaging Het
Clec4n G A 6: 123,246,567 M170I possibly damaging Het
Cp G T 3: 19,978,952 A648S probably benign Het
Creld2 G A 15: 88,820,631 W103* probably null Het
Dnah8 A G 17: 30,855,936 D4543G probably damaging Het
Elp3 A G 14: 65,547,921 V477A probably damaging Het
Exoc6b A G 6: 84,908,223 S245P probably benign Het
Fkbp9 G T 6: 56,860,697 G312V probably damaging Het
Htr4 A G 18: 62,437,553 I226M probably damaging Het
Impa2 G A 18: 67,318,427 V264I probably benign Het
Kmt2c C A 5: 25,310,983 V2621F possibly damaging Het
Lif A G 11: 4,269,237 D172G probably damaging Het
Llgl1 C A 11: 60,704,733 H82N probably benign Het
Lrwd1 T C 5: 136,133,419 I162M probably benign Het
Mdn1 T A 4: 32,694,511 I1078N probably damaging Het
Muc1 A T 3: 89,230,438 T196S probably benign Het
Myh7b T C 2: 155,622,714 L657P probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Ppp1cb T C 5: 32,487,671 M55T probably damaging Het
Ppp1r9a T C 6: 5,159,697 M1078T possibly damaging Het
Rarg T C 15: 102,241,160 T125A probably damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Slc5a7 G A 17: 54,293,011 R125C probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tigit G T 16: 43,649,122 T202N probably benign Het
Tmem132b C T 5: 125,783,542 A617V possibly damaging Het
Tpm1 T C 9: 67,031,118 probably null Het
Ubr3 A G 2: 69,938,315 probably benign Het
Vcan T A 13: 89,704,303 D846V probably damaging Het
Vmn1r16 T G 6: 57,323,236 N134H probably damaging Het
Other mutations in Kif20b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Kif20b APN 19 34947660 missense possibly damaging 0.77
IGL01021:Kif20b APN 19 34938260 missense possibly damaging 0.89
IGL01590:Kif20b APN 19 34954726 missense possibly damaging 0.87
IGL01691:Kif20b APN 19 34935743 splice site probably benign
IGL01730:Kif20b APN 19 34950523 nonsense probably null
IGL02078:Kif20b APN 19 34935644 missense probably damaging 1.00
IGL02174:Kif20b APN 19 34934458 splice site probably benign
IGL02536:Kif20b APN 19 34974559 missense probably benign 0.42
IGL03029:Kif20b APN 19 34950913 missense probably benign
IGL03186:Kif20b APN 19 34934944 missense probably benign 0.45
IGL03205:Kif20b APN 19 34959463 missense probably damaging 1.00
IGL03493:Kif20b APN 19 34959550 nonsense probably null
R0319:Kif20b UTSW 19 34947732 splice site probably benign
R1069:Kif20b UTSW 19 34950851 missense probably damaging 1.00
R1255:Kif20b UTSW 19 34950106 missense probably benign 0.08
R1352:Kif20b UTSW 19 34924635 missense probably benign
R1466:Kif20b UTSW 19 34950599 missense probably benign 0.00
R1466:Kif20b UTSW 19 34950599 missense probably benign 0.00
R1473:Kif20b UTSW 19 34974496 missense possibly damaging 0.93
R1545:Kif20b UTSW 19 34928918 missense probably damaging 1.00
R1647:Kif20b UTSW 19 34936790 missense possibly damaging 0.65
R1648:Kif20b UTSW 19 34936790 missense possibly damaging 0.65
R1752:Kif20b UTSW 19 34938336 missense probably benign 0.13
R1835:Kif20b UTSW 19 34956038 missense probably damaging 1.00
R1889:Kif20b UTSW 19 34941208 unclassified probably benign
R1937:Kif20b UTSW 19 34952878 missense possibly damaging 0.73
R2112:Kif20b UTSW 19 34931732 missense probably benign 0.04
R2315:Kif20b UTSW 19 34931599 missense probably damaging 1.00
R2385:Kif20b UTSW 19 34959419 missense probably damaging 0.98
R2867:Kif20b UTSW 19 34940128 missense probably damaging 1.00
R2867:Kif20b UTSW 19 34940128 missense probably damaging 1.00
R3086:Kif20b UTSW 19 34929715 missense probably damaging 1.00
R3116:Kif20b UTSW 19 34970080 missense probably benign 0.38
R3407:Kif20b UTSW 19 34950500 missense probably damaging 1.00
R3834:Kif20b UTSW 19 34935028 missense probably damaging 1.00
R3882:Kif20b UTSW 19 34950080 missense probably damaging 1.00
R4698:Kif20b UTSW 19 34951544 missense probably damaging 1.00
R4721:Kif20b UTSW 19 34938373 missense probably benign 0.41
R4883:Kif20b UTSW 19 34966122 missense probably benign 0.00
R4901:Kif20b UTSW 19 34934436 missense probably benign 0.00
R4923:Kif20b UTSW 19 34941211 critical splice acceptor site probably null
R5538:Kif20b UTSW 19 34952964 nonsense probably null
R5540:Kif20b UTSW 19 34938460 missense probably benign 0.01
R5558:Kif20b UTSW 19 34951549 missense probably damaging 1.00
R5580:Kif20b UTSW 19 34949728 splice site probably null
R5934:Kif20b UTSW 19 34941321 missense probably benign 0.02
R6019:Kif20b UTSW 19 34950464 missense probably benign 0.00
R6464:Kif20b UTSW 19 34934441 missense probably benign
R6613:Kif20b UTSW 19 34936984 nonsense probably null
R6745:Kif20b UTSW 19 34928876 missense possibly damaging 0.94
R7097:Kif20b UTSW 19 34974492 missense probably damaging 0.98
R7237:Kif20b UTSW 19 34950605 missense probably damaging 1.00
R7260:Kif20b UTSW 19 34950210 missense probably damaging 1.00
R7373:Kif20b UTSW 19 34935671 missense probably damaging 1.00
R7418:Kif20b UTSW 19 34929687 missense probably damaging 0.99
R7814:Kif20b UTSW 19 34950955 missense possibly damaging 0.63
R7861:Kif20b UTSW 19 34939922 missense probably damaging 1.00
R7944:Kif20b UTSW 19 34939922 missense probably damaging 1.00
Z1088:Kif20b UTSW 19 34950451 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTACCTGTGGCGGATGATAGAAGG -3'
(R):5'- TCTCGGAAAGGCACATGCTGAAC -3'

Sequencing Primer
(F):5'- ACTAGTGTAGAGAAGTCCAGTTTG -3'
(R):5'- GGCACATGCTGAACCCTATG -3'
Posted On2014-01-05