Incidental Mutation 'R1138:Igfbp2'
ID95257
Institutional Source Beutler Lab
Gene Symbol Igfbp2
Ensembl Gene ENSMUSG00000039323
Gene Nameinsulin-like growth factor binding protein 2
SynonymsIGFBP-2, Igfbp-2
MMRRC Submission 039211-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.460) question?
Stock #R1138 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location72824503-72852474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72849098 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 133 (D133G)
Ref Sequence ENSEMBL: ENSMUSP00000046610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047328] [ENSMUST00000120564]
Predicted Effect probably damaging
Transcript: ENSMUST00000047328
AA Change: D133G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000046610
Gene: ENSMUSG00000039323
AA Change: D133G

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
IB 38 117 2.08e-35 SMART
TY 238 290 1.17e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120564
SMART Domains Protein: ENSMUSP00000112706
Gene: ENSMUSG00000039323

DomainStartEndE-ValueType
TY 91 143 1.17e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155703
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is one of several similar proteins that bind insulin-like growth factors I and II (Igf-I and Igf-II). The encoded protein can be secreted into the bloodstream, where it binds Igf-I and Igf-II with high affinity, or it can remain intracellular, interacting with many different ligands. Two transcript variants, one encoding a secreted isoform and the other encoding a nonsecreted isoform, have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutation of this gene results in reduced spleen, heart and kidney size and increased liver weight. Homozygotes for another allele exhibit a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933408B17Rik C T 18: 34,580,244 V258I probably benign Het
Abca4 T A 3: 122,173,848 N974K probably benign Het
Bub1b C T 2: 118,623,089 T467I probably benign Het
Bzw1 T C 1: 58,401,386 Y173H probably damaging Het
Chl1 A G 6: 103,693,179 D526G probably benign Het
Dnajc22 AGACACT A 15: 99,104,427 probably benign Het
Dstyk A G 1: 132,463,486 N920S probably benign Het
Glra3 A G 8: 56,088,976 probably null Het
Hpgd G A 8: 56,307,677 M136I probably benign Het
Lin54 A G 5: 100,444,134 M642T probably damaging Het
Map7d1 T C 4: 126,242,119 T99A possibly damaging Het
Mfsd4b5 C T 10: 39,975,154 C35Y probably damaging Het
Mycbp2 G T 14: 103,174,826 N2570K possibly damaging Het
Nr4a2 T C 2: 57,112,379 S21G probably damaging Het
Oacyl T A 18: 65,725,450 L209Q probably damaging Het
Olfr1233 T C 2: 89,340,090 I71V probably benign Het
Pkd1 C A 17: 24,586,032 N3218K probably damaging Het
Scyl3 A G 1: 163,933,665 N46S possibly damaging Het
Sh2d3c G T 2: 32,749,405 R349L probably benign Het
Siae G A 9: 37,642,692 R366H probably damaging Het
Tmem108 T C 9: 103,498,969 N427S possibly damaging Het
Other mutations in Igfbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Igfbp2 APN 1 72849128 missense probably benign 0.02
IGL02435:Igfbp2 APN 1 72852086 missense probably damaging 1.00
R1688:Igfbp2 UTSW 1 72824966 critical splice donor site probably null
R2045:Igfbp2 UTSW 1 72852151 missense probably benign 0.13
R5704:Igfbp2 UTSW 1 72852144 missense probably benign 0.02
R6128:Igfbp2 UTSW 1 72824799 missense probably damaging 1.00
R6395:Igfbp2 UTSW 1 72824919 missense probably damaging 1.00
R6836:Igfbp2 UTSW 1 72849658 missense probably damaging 1.00
R7002:Igfbp2 UTSW 1 72849645 missense probably damaging 0.99
R7511:Igfbp2 UTSW 1 72852005 missense probably damaging 1.00
R7586:Igfbp2 UTSW 1 72849148 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAACACCCAGCTAAGTTGTGGAGG -3'
(R):5'- TGTGCAGGGAGTAGAGATGTTCCAG -3'

Sequencing Primer
(F):5'- CTAAGTTGTGGAGGCTGGGC -3'
(R):5'- TAGGGCAGTATCAGTGTCCAC -3'
Posted On2014-01-05