Incidental Mutation 'R1138:Map7d1'
ID95279
Institutional Source Beutler Lab
Gene Symbol Map7d1
Ensembl Gene ENSMUSG00000028849
Gene NameMAP7 domain containing 1
SynonymsMtap7d1, Parcc1, Rprc1
MMRRC Submission 039211-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.765) question?
Stock #R1138 (G1)
Quality Score206
Status Not validated
Chromosome4
Chromosomal Location126232167-126256343 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126242119 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 99 (T99A)
Ref Sequence ENSEMBL: ENSMUSP00000101738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061143] [ENSMUST00000106132] [ENSMUST00000122129]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061143
AA Change: T99A

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000054338
Gene: ENSMUSG00000028849
AA Change: T99A

DomainStartEndE-ValueType
low complexity region 25 47 N/A INTRINSIC
low complexity region 110 123 N/A INTRINSIC
coiled coil region 163 224 N/A INTRINSIC
low complexity region 323 343 N/A INTRINSIC
coiled coil region 414 444 N/A INTRINSIC
low complexity region 460 471 N/A INTRINSIC
low complexity region 480 497 N/A INTRINSIC
low complexity region 533 558 N/A INTRINSIC
Pfam:MAP7 587 735 7.1e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106132
AA Change: T99A

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101738
Gene: ENSMUSG00000028849
AA Change: T99A

DomainStartEndE-ValueType
low complexity region 25 47 N/A INTRINSIC
low complexity region 110 123 N/A INTRINSIC
coiled coil region 163 224 N/A INTRINSIC
coiled coil region 342 372 N/A INTRINSIC
low complexity region 388 399 N/A INTRINSIC
low complexity region 408 425 N/A INTRINSIC
low complexity region 461 486 N/A INTRINSIC
Pfam:MAP7 510 668 1.4e-61 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000122129
AA Change: T99A

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113250
Gene: ENSMUSG00000028849
AA Change: T99A

DomainStartEndE-ValueType
low complexity region 25 47 N/A INTRINSIC
low complexity region 110 123 N/A INTRINSIC
coiled coil region 163 224 N/A INTRINSIC
coiled coil region 382 412 N/A INTRINSIC
low complexity region 428 439 N/A INTRINSIC
low complexity region 448 465 N/A INTRINSIC
low complexity region 501 526 N/A INTRINSIC
Pfam:MAP7 550 708 1.5e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125981
SMART Domains Protein: ENSMUSP00000120292
Gene: ENSMUSG00000028849

DomainStartEndE-ValueType
low complexity region 68 88 N/A INTRINSIC
coiled coil region 158 188 N/A INTRINSIC
low complexity region 205 216 N/A INTRINSIC
low complexity region 225 242 N/A INTRINSIC
low complexity region 278 303 N/A INTRINSIC
Pfam:MAP7 332 480 1.5e-41 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933408B17Rik C T 18: 34,580,244 V258I probably benign Het
Abca4 T A 3: 122,173,848 N974K probably benign Het
Bub1b C T 2: 118,623,089 T467I probably benign Het
Bzw1 T C 1: 58,401,386 Y173H probably damaging Het
Chl1 A G 6: 103,693,179 D526G probably benign Het
Dnajc22 AGACACT A 15: 99,104,427 probably benign Het
Dstyk A G 1: 132,463,486 N920S probably benign Het
Glra3 A G 8: 56,088,976 probably null Het
Hpgd G A 8: 56,307,677 M136I probably benign Het
Igfbp2 A G 1: 72,849,098 D133G probably damaging Het
Lin54 A G 5: 100,444,134 M642T probably damaging Het
Mfsd4b5 C T 10: 39,975,154 C35Y probably damaging Het
Mycbp2 G T 14: 103,174,826 N2570K possibly damaging Het
Nr4a2 T C 2: 57,112,379 S21G probably damaging Het
Oacyl T A 18: 65,725,450 L209Q probably damaging Het
Olfr1233 T C 2: 89,340,090 I71V probably benign Het
Pkd1 C A 17: 24,586,032 N3218K probably damaging Het
Scyl3 A G 1: 163,933,665 N46S possibly damaging Het
Sh2d3c G T 2: 32,749,405 R349L probably benign Het
Siae G A 9: 37,642,692 R366H probably damaging Het
Tmem108 T C 9: 103,498,969 N427S possibly damaging Het
Other mutations in Map7d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Map7d1 APN 4 126238605 missense probably damaging 1.00
IGL02298:Map7d1 APN 4 126233921 missense unknown
R0136:Map7d1 UTSW 4 126236631 critical splice donor site probably null
R0362:Map7d1 UTSW 4 126234994 missense probably damaging 1.00
R1499:Map7d1 UTSW 4 126234765 critical splice donor site probably null
R1692:Map7d1 UTSW 4 126242308 missense probably damaging 0.99
R3805:Map7d1 UTSW 4 126237291 splice site probably null
R4369:Map7d1 UTSW 4 126235073 missense probably damaging 0.99
R4814:Map7d1 UTSW 4 126234321 critical splice donor site probably null
R4893:Map7d1 UTSW 4 126233222 missense unknown
R4898:Map7d1 UTSW 4 126233225 missense unknown
R4911:Map7d1 UTSW 4 126236691 missense probably damaging 1.00
R4949:Map7d1 UTSW 4 126235053 nonsense probably null
R5189:Map7d1 UTSW 4 126242304 unclassified probably null
R6198:Map7d1 UTSW 4 126241843 missense probably damaging 1.00
R6336:Map7d1 UTSW 4 126236682 missense probably damaging 1.00
R6558:Map7d1 UTSW 4 126232909 missense unknown
R6781:Map7d1 UTSW 4 126240751 frame shift probably null
R7177:Map7d1 UTSW 4 126236985 missense probably damaging 1.00
R7204:Map7d1 UTSW 4 126256015 critical splice donor site probably null
R7269:Map7d1 UTSW 4 126232873 missense unknown
R7486:Map7d1 UTSW 4 126234386 missense unknown
R7560:Map7d1 UTSW 4 126236636 missense probably damaging 1.00
Z1177:Map7d1 UTSW 4 126234377 missense unknown
Predicted Primers PCR Primer
(F):5'- AGTGAGCAAACCACAGGGTCTGAC -3'
(R):5'- ACAGGGCAGATTGCTGTGTGAAC -3'

Sequencing Primer
(F):5'- AGAGGTCACACACCTTGCTT -3'
(R):5'- CAGATTGCTGTGTGAACTGACAATAC -3'
Posted On2014-01-05