Incidental Mutation 'R1138:Hpgd'
ID 95296
Institutional Source Beutler Lab
Gene Symbol Hpgd
Ensembl Gene ENSMUSG00000031613
Gene Name hydroxyprostaglandin dehydrogenase 15 (NAD)
Synonyms 15-PGDH
MMRRC Submission 039211-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1138 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 56747620-56774078 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 56760712 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 136 (M136I)
Ref Sequence ENSEMBL: ENSMUSP00000034026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034026]
AlphaFold Q8VCC1
Predicted Effect probably benign
Transcript: ENSMUST00000034026
AA Change: M136I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000034026
Gene: ENSMUSG00000031613
AA Change: M136I

DomainStartEndE-ValueType
Pfam:KR 6 175 6.6e-11 PFAM
Pfam:adh_short 6 199 1.7e-59 PFAM
Pfam:adh_short_C2 12 252 1.3e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209271
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the short-chain nonmetalloenzyme alcohol dehydrogenase protein family. The encoded enzyme is responsible for the metabolism of prostaglandins, which function in a variety of physiologic and cellular processes such as inflammation. Mutations in this gene result in primary autosomal recessive hypertrophic osteoarthropathy and cranioosteoarthropathy. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous mutation of this gene results failure of the ductus arteriosus to close and perinatal lethality. Mutant animals die within 12-48 hours after birth due to congestive heart failure. Mice homozygous for a hypomorphic allele exhibit preterm labor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 121,967,497 (GRCm39) N974K probably benign Het
Brd8dc C T 18: 34,713,297 (GRCm39) V258I probably benign Het
Bub1b C T 2: 118,453,570 (GRCm39) T467I probably benign Het
Bzw1 T C 1: 58,440,545 (GRCm39) Y173H probably damaging Het
Chl1 A G 6: 103,670,140 (GRCm39) D526G probably benign Het
Dnajc22 AGACACT A 15: 99,002,308 (GRCm39) probably benign Het
Dstyk A G 1: 132,391,224 (GRCm39) N920S probably benign Het
Glra3 A G 8: 56,542,011 (GRCm39) probably null Het
Igfbp2 A G 1: 72,888,257 (GRCm39) D133G probably damaging Het
Lin54 A G 5: 100,591,993 (GRCm39) M642T probably damaging Het
Map7d1 T C 4: 126,135,912 (GRCm39) T99A possibly damaging Het
Mfsd4b5 C T 10: 39,851,150 (GRCm39) C35Y probably damaging Het
Mycbp2 G T 14: 103,412,262 (GRCm39) N2570K possibly damaging Het
Nr4a2 T C 2: 57,002,391 (GRCm39) S21G probably damaging Het
Oacyl T A 18: 65,858,521 (GRCm39) L209Q probably damaging Het
Or4c125 T C 2: 89,170,434 (GRCm39) I71V probably benign Het
Pkd1 C A 17: 24,805,006 (GRCm39) N3218K probably damaging Het
Scyl3 A G 1: 163,761,234 (GRCm39) N46S possibly damaging Het
Sh2d3c G T 2: 32,639,417 (GRCm39) R349L probably benign Het
Siae G A 9: 37,553,988 (GRCm39) R366H probably damaging Het
Tmem108 T C 9: 103,376,168 (GRCm39) N427S possibly damaging Het
Other mutations in Hpgd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01993:Hpgd APN 8 56,772,097 (GRCm39) missense probably benign 0.04
R0703:Hpgd UTSW 8 56,748,074 (GRCm39) missense probably damaging 1.00
R0705:Hpgd UTSW 8 56,748,074 (GRCm39) missense probably damaging 1.00
R2081:Hpgd UTSW 8 56,760,677 (GRCm39) missense probably benign
R3177:Hpgd UTSW 8 56,751,448 (GRCm39) missense probably damaging 1.00
R3277:Hpgd UTSW 8 56,751,448 (GRCm39) missense probably damaging 1.00
R3782:Hpgd UTSW 8 56,751,453 (GRCm39) missense probably damaging 1.00
R4774:Hpgd UTSW 8 56,751,454 (GRCm39) missense probably damaging 1.00
R4874:Hpgd UTSW 8 56,770,838 (GRCm39) missense possibly damaging 0.78
R5501:Hpgd UTSW 8 56,751,391 (GRCm39) missense probably benign 0.04
R5828:Hpgd UTSW 8 56,772,106 (GRCm39) missense probably benign 0.10
R5846:Hpgd UTSW 8 56,760,702 (GRCm39) missense possibly damaging 0.90
R6136:Hpgd UTSW 8 56,747,987 (GRCm39) missense probably damaging 1.00
R7252:Hpgd UTSW 8 56,751,461 (GRCm39) missense probably damaging 1.00
R8841:Hpgd UTSW 8 56,760,709 (GRCm39) missense probably damaging 1.00
R9629:Hpgd UTSW 8 56,751,419 (GRCm39) missense
R9659:Hpgd UTSW 8 56,772,075 (GRCm39) missense probably damaging 1.00
R9731:Hpgd UTSW 8 56,751,391 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTCCCTATATGCCTGGCTTAGCAAC -3'
(R):5'- TCACAAGGAAGTAGAGGCCACTTCA -3'

Sequencing Primer
(F):5'- CTGGCTTAGCAACGTCTTTG -3'
(R):5'- acacacacaaacacacacac -3'
Posted On 2014-01-05