Incidental Mutation 'R1033:Akap6'
ID95311
Institutional Source Beutler Lab
Gene Symbol Akap6
Ensembl Gene ENSMUSG00000061603
Gene NameA kinase (PRKA) anchor protein 6
Synonyms
MMRRC Submission 039132-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.815) question?
Stock #R1033 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location52699383-53155599 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 53069222 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 1036 (D1036A)
Ref Sequence ENSEMBL: ENSMUSP00000093406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095737] [ENSMUST00000219786]
Predicted Effect probably damaging
Transcript: ENSMUST00000095737
AA Change: D1036A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000093406
Gene: ENSMUSG00000061603
AA Change: D1036A

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
Blast:SPEC 66 168 2e-50 BLAST
low complexity region 441 455 N/A INTRINSIC
low complexity region 544 555 N/A INTRINSIC
low complexity region 569 587 N/A INTRINSIC
low complexity region 640 651 N/A INTRINSIC
low complexity region 694 708 N/A INTRINSIC
SPEC 779 880 1.06e-1 SMART
SPEC 959 1057 1.45e0 SMART
SPEC 1078 1185 2.56e-2 SMART
low complexity region 1316 1332 N/A INTRINSIC
low complexity region 1555 1568 N/A INTRINSIC
low complexity region 1610 1622 N/A INTRINSIC
low complexity region 1683 1698 N/A INTRINSIC
low complexity region 1737 1781 N/A INTRINSIC
low complexity region 1899 1910 N/A INTRINSIC
low complexity region 2019 2031 N/A INTRINSIC
low complexity region 2104 2115 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000219786
AA Change: D1036A

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is highly expressed in various brain regions and cardiac and skeletal muscle. It is specifically localized to the sarcoplasmic reticulum and nuclear membrane, and is involved in anchoring PKA to the nuclear membrane or sarcoplasmic reticulum. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in partial embryonic lethality; surviving homozygotes display a decreased body weight, craniofacial defects and reduced viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G A 1: 26,682,385 P1238L probably benign Het
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Alg6 T C 4: 99,762,033 S497P probably benign Het
Arhgap10 T A 8: 77,257,347 I700L possibly damaging Het
Atp11a A G 8: 12,828,555 Y377C probably damaging Het
Atp2b2 A T 6: 113,793,888 probably null Het
Card14 T A 11: 119,338,370 V702D probably damaging Het
Ccdc17 C T 4: 116,596,880 R32* probably null Het
Cdh7 A T 1: 110,085,053 D372V probably damaging Het
Cfap54 A T 10: 92,839,449 I2870N probably benign Het
Cped1 G T 6: 22,016,951 V100F probably damaging Het
Dapk1 T C 13: 60,721,865 probably null Het
Exoc4 G A 6: 33,265,987 G45D probably damaging Het
Fam110b A T 4: 5,799,440 N286I probably benign Het
Fbxo10 A T 4: 45,062,236 C97S probably damaging Het
Frem3 A T 8: 80,695,157 H2062L probably benign Het
Frk T C 10: 34,608,458 C476R probably damaging Het
Gm10471 T C 5: 26,089,127 K18E probably benign Het
Gm10542 A G 18: 44,204,601 T49A probably benign Het
Gm128 A G 3: 95,240,011 V324A possibly damaging Het
Gpr141 C T 13: 19,751,710 M298I probably benign Het
Gxylt1 T C 15: 93,245,077 E369G probably benign Het
Hpse2 A G 19: 42,913,199 V368A probably benign Het
Ice1 A T 13: 70,606,594 S458T probably damaging Het
Itgb7 T A 15: 102,223,554 D198V probably damaging Het
Kcnk10 A G 12: 98,518,670 V72A possibly damaging Het
Magel2 A G 7: 62,380,050 M901V unknown Het
Mgam A T 6: 40,680,624 Y971F probably benign Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mpp6 T C 6: 50,183,736 Y326H probably damaging Het
Mug1 A T 6: 121,880,551 D1078V probably damaging Het
Myom2 G A 8: 15,108,934 R870H probably benign Het
Nek8 A T 11: 78,171,285 L71Q probably null Het
Nox4 T A 7: 87,374,413 D502E probably damaging Het
Nsmaf G A 4: 6,438,054 P73S probably damaging Het
Nup205 C T 6: 35,227,442 A1421V probably benign Het
Nxpe4 T C 9: 48,393,233 F207L probably damaging Het
Olfr1043 A G 2: 86,162,850 I33T possibly damaging Het
Olfr1282 A T 2: 111,335,802 I92N probably damaging Het
Olfr410 A C 11: 74,334,636 N198K possibly damaging Het
Olfr59 A C 11: 74,288,666 T7P probably damaging Het
Prkdc T C 16: 15,767,951 L2451P probably damaging Het
Rad51ap2 C T 12: 11,456,251 S58F probably damaging Het
Rbbp8 A G 18: 11,742,705 R892G probably benign Het
Rock1 A G 18: 10,067,535 S1333P probably benign Het
Rpl7 A G 1: 16,102,504 I197T probably benign Het
Sar1a C A 10: 61,685,616 Q81K probably damaging Het
Shank1 A T 7: 44,356,796 H1979L possibly damaging Het
Slc10a2 C T 8: 5,104,889 V99M probably damaging Het
Slc22a30 G A 19: 8,335,801 Q436* probably null Het
Szt2 C T 4: 118,387,106 R1305H probably damaging Het
Ubash3a G A 17: 31,208,212 G32S probably damaging Het
Vmn1r200 G A 13: 22,395,890 D279N probably damaging Het
Zbtb8a T C 4: 129,354,221 D419G possibly damaging Het
Other mutations in Akap6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Akap6 APN 12 53140980 missense possibly damaging 0.79
IGL00505:Akap6 APN 12 52887102 missense possibly damaging 0.92
IGL01134:Akap6 APN 12 52937217 missense probably damaging 0.96
IGL01458:Akap6 APN 12 52886818 nonsense probably null
IGL01589:Akap6 APN 12 53139664 missense probably damaging 1.00
IGL01592:Akap6 APN 12 53142142 missense probably damaging 1.00
IGL01738:Akap6 APN 12 52886817 missense probably damaging 0.99
IGL01867:Akap6 APN 12 52888008 missense probably damaging 1.00
IGL02025:Akap6 APN 12 53140335 missense probably benign
IGL02041:Akap6 APN 12 53140653 missense probably damaging 1.00
IGL02058:Akap6 APN 12 53140555 missense probably damaging 1.00
IGL02194:Akap6 APN 12 52886823 missense probably benign 0.00
IGL02226:Akap6 APN 12 53010467 splice site probably benign
IGL02323:Akap6 APN 12 53140429 missense probably benign 0.00
IGL02449:Akap6 APN 12 53140188 missense probably damaging 1.00
IGL02475:Akap6 APN 12 53139494 missense probably benign 0.03
IGL02546:Akap6 APN 12 52880738 missense probably damaging 1.00
IGL02547:Akap6 APN 12 53140696 missense probably damaging 1.00
IGL02588:Akap6 APN 12 52886499 nonsense probably null
IGL02608:Akap6 APN 12 53010606 missense probably benign 0.39
IGL02884:Akap6 APN 12 52886622 missense probably benign 0.00
IGL02945:Akap6 APN 12 52880837 missense probably damaging 1.00
IGL03029:Akap6 APN 12 52886412 missense probably damaging 1.00
IGL03129:Akap6 APN 12 53140306 missense probably damaging 1.00
R0133:Akap6 UTSW 12 53139471 nonsense probably null
R0166:Akap6 UTSW 12 53140924 missense probably benign 0.04
R0189:Akap6 UTSW 12 53141254 missense probably benign 0.41
R0532:Akap6 UTSW 12 52887983 missense probably benign 0.00
R0632:Akap6 UTSW 12 52937148 missense probably damaging 1.00
R0666:Akap6 UTSW 12 52911808 missense probably damaging 1.00
R0723:Akap6 UTSW 12 53141902 missense probably damaging 1.00
R0763:Akap6 UTSW 12 53142214 missense possibly damaging 0.93
R0785:Akap6 UTSW 12 52886622 missense probably benign 0.00
R0879:Akap6 UTSW 12 52880799 missense probably damaging 1.00
R0880:Akap6 UTSW 12 53139508 missense possibly damaging 0.93
R1055:Akap6 UTSW 12 52880672 nonsense probably null
R1199:Akap6 UTSW 12 52796190 missense probably damaging 1.00
R1295:Akap6 UTSW 12 52887029 missense probably damaging 1.00
R1389:Akap6 UTSW 12 53139520 missense probably benign 0.15
R1471:Akap6 UTSW 12 53141496 missense probably benign 0.05
R1483:Akap6 UTSW 12 52796087 missense probably damaging 1.00
R1512:Akap6 UTSW 12 52937154 missense probably damaging 1.00
R1648:Akap6 UTSW 12 53142006 nonsense probably null
R1791:Akap6 UTSW 12 53069125 missense probably damaging 1.00
R1888:Akap6 UTSW 12 53142175 missense possibly damaging 0.88
R1888:Akap6 UTSW 12 53142175 missense possibly damaging 0.88
R1891:Akap6 UTSW 12 53142175 missense possibly damaging 0.88
R1899:Akap6 UTSW 12 53141852 missense possibly damaging 0.95
R1917:Akap6 UTSW 12 53104612 missense probably benign 0.13
R1970:Akap6 UTSW 12 52938475 missense probably damaging 0.96
R1987:Akap6 UTSW 12 53140795 missense possibly damaging 0.78
R1988:Akap6 UTSW 12 53140795 missense possibly damaging 0.78
R2153:Akap6 UTSW 12 53141404 missense probably benign 0.03
R2567:Akap6 UTSW 12 52938373 missense probably damaging 1.00
R2568:Akap6 UTSW 12 52887278 missense possibly damaging 0.77
R3025:Akap6 UTSW 12 53140143 missense probably benign
R3051:Akap6 UTSW 12 52887033 missense probably damaging 1.00
R3195:Akap6 UTSW 12 53072457 nonsense probably null
R3196:Akap6 UTSW 12 53072457 nonsense probably null
R3426:Akap6 UTSW 12 52888034 missense probably damaging 1.00
R3783:Akap6 UTSW 12 52880769 missense probably damaging 1.00
R3934:Akap6 UTSW 12 53140444 missense possibly damaging 0.92
R3936:Akap6 UTSW 12 53140444 missense possibly damaging 0.92
R3967:Akap6 UTSW 12 53141453 missense probably damaging 1.00
R3970:Akap6 UTSW 12 53141453 missense probably damaging 1.00
R4042:Akap6 UTSW 12 53139379 critical splice acceptor site probably null
R4095:Akap6 UTSW 12 53139462 missense probably damaging 1.00
R4152:Akap6 UTSW 12 53140407 missense probably benign 0.45
R4231:Akap6 UTSW 12 53141038 missense probably damaging 1.00
R4232:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4233:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4234:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4235:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4236:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4475:Akap6 UTSW 12 53141643 missense probably benign 0.00
R4513:Akap6 UTSW 12 52796004 missense probably benign 0.03
R4686:Akap6 UTSW 12 52887623 frame shift probably null
R4724:Akap6 UTSW 12 52795885 missense possibly damaging 0.80
R4782:Akap6 UTSW 12 52887623 frame shift probably null
R4852:Akap6 UTSW 12 53104675 missense probably damaging 1.00
R5024:Akap6 UTSW 12 53142562 missense probably benign 0.01
R5116:Akap6 UTSW 12 53141515 missense probably benign 0.01
R5164:Akap6 UTSW 12 53142466 missense probably benign
R5225:Akap6 UTSW 12 52886546 missense probably damaging 1.00
R5269:Akap6 UTSW 12 53139843 missense probably damaging 0.99
R5352:Akap6 UTSW 12 52796097 missense probably damaging 1.00
R5496:Akap6 UTSW 12 53140653 missense possibly damaging 0.87
R5551:Akap6 UTSW 12 52795964 missense probably damaging 1.00
R5997:Akap6 UTSW 12 52937233 critical splice donor site probably null
R6137:Akap6 UTSW 12 53140354 missense probably damaging 1.00
R6151:Akap6 UTSW 12 53025792 missense probably damaging 1.00
R6169:Akap6 UTSW 12 53142358 missense probably benign
R6307:Akap6 UTSW 12 53141568 missense possibly damaging 0.85
R6351:Akap6 UTSW 12 53142025 missense probably damaging 0.98
R6479:Akap6 UTSW 12 53141169 missense probably damaging 1.00
R6502:Akap6 UTSW 12 53140215 missense probably damaging 1.00
R6760:Akap6 UTSW 12 53139778 missense probably damaging 1.00
R6778:Akap6 UTSW 12 53025816 missense probably damaging 1.00
R6837:Akap6 UTSW 12 53141262 missense probably damaging 1.00
R6896:Akap6 UTSW 12 52887494 missense probably benign 0.06
R6917:Akap6 UTSW 12 53069168 missense probably null 0.97
R6983:Akap6 UTSW 12 52887653 missense probably damaging 1.00
R7142:Akap6 UTSW 12 52887364 missense probably benign 0.02
R7143:Akap6 UTSW 12 52887364 missense probably benign 0.02
R7216:Akap6 UTSW 12 53140457 missense probably benign 0.02
R7297:Akap6 UTSW 12 52887364 missense probably benign 0.02
R7356:Akap6 UTSW 12 52911864 missense probably damaging 1.00
R7378:Akap6 UTSW 12 53142574 missense probably benign 0.00
R7382:Akap6 UTSW 12 53142171 missense probably benign 0.00
R7498:Akap6 UTSW 12 53142705 nonsense probably null
R7542:Akap6 UTSW 12 53069234 missense probably damaging 1.00
X0062:Akap6 UTSW 12 53142361 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- CGCACACTAACGAGTCATCCTTCTC -3'
(R):5'- AGCGTGACAGGCCGTGTATATCAG -3'

Sequencing Primer
(F):5'- AACGAGTCATCCTTCTCTTGCC -3'
(R):5'- GAGGAAAAGCAATGTTTTCCCC -3'
Posted On2014-01-05