Incidental Mutation 'R1138:Oacyl'
ID95325
Institutional Source Beutler Lab
Gene Symbol Oacyl
Ensembl Gene ENSMUSG00000046610
Gene NameO-acyltransferase like
Synonyms5330437I02Rik
MMRRC Submission 039211-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R1138 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location65698268-65751601 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 65725450 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 209 (L209Q)
Ref Sequence ENSEMBL: ENSMUSP00000113626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115097] [ENSMUST00000117694]
Predicted Effect probably damaging
Transcript: ENSMUST00000115097
AA Change: L282Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110749
Gene: ENSMUSG00000046610
AA Change: L282Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
NRF 24 145 3.58e-13 SMART
Blast:NRF 152 191 1e-6 BLAST
Pfam:Acyl_transf_3 274 664 6.8e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117694
AA Change: L209Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113626
Gene: ENSMUSG00000046610
AA Change: L209Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:NRF 24 118 4e-14 BLAST
Pfam:Acyl_transf_3 201 591 6.7e-23 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933408B17Rik C T 18: 34,580,244 V258I probably benign Het
Abca4 T A 3: 122,173,848 N974K probably benign Het
Bub1b C T 2: 118,623,089 T467I probably benign Het
Bzw1 T C 1: 58,401,386 Y173H probably damaging Het
Chl1 A G 6: 103,693,179 D526G probably benign Het
Dnajc22 AGACACT A 15: 99,104,427 probably benign Het
Dstyk A G 1: 132,463,486 N920S probably benign Het
Glra3 A G 8: 56,088,976 probably null Het
Hpgd G A 8: 56,307,677 M136I probably benign Het
Igfbp2 A G 1: 72,849,098 D133G probably damaging Het
Lin54 A G 5: 100,444,134 M642T probably damaging Het
Map7d1 T C 4: 126,242,119 T99A possibly damaging Het
Mfsd4b5 C T 10: 39,975,154 C35Y probably damaging Het
Mycbp2 G T 14: 103,174,826 N2570K possibly damaging Het
Nr4a2 T C 2: 57,112,379 S21G probably damaging Het
Olfr1233 T C 2: 89,340,090 I71V probably benign Het
Pkd1 C A 17: 24,586,032 N3218K probably damaging Het
Scyl3 A G 1: 163,933,665 N46S possibly damaging Het
Sh2d3c G T 2: 32,749,405 R349L probably benign Het
Siae G A 9: 37,642,692 R366H probably damaging Het
Tmem108 T C 9: 103,498,969 N427S possibly damaging Het
Other mutations in Oacyl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Oacyl APN 18 65749640 missense possibly damaging 0.65
IGL00972:Oacyl APN 18 65725501 missense possibly damaging 0.95
IGL01970:Oacyl APN 18 65749714 missense possibly damaging 0.77
IGL02030:Oacyl APN 18 65737910 missense probably damaging 0.99
IGL02706:Oacyl APN 18 65749721 missense probably damaging 1.00
R0529:Oacyl UTSW 18 65742219 missense probably damaging 0.97
R0607:Oacyl UTSW 18 65747891 missense possibly damaging 0.61
R0724:Oacyl UTSW 18 65737825 splice site probably benign
R1482:Oacyl UTSW 18 65737972 missense probably damaging 1.00
R1551:Oacyl UTSW 18 65742209 missense probably benign 0.02
R1649:Oacyl UTSW 18 65750096 missense probably damaging 1.00
R1919:Oacyl UTSW 18 65710547 missense possibly damaging 0.87
R4271:Oacyl UTSW 18 65737967 missense probably damaging 1.00
R5443:Oacyl UTSW 18 65750182 missense probably benign
R5525:Oacyl UTSW 18 65745356 missense probably benign 0.00
R5879:Oacyl UTSW 18 65749672 missense probably damaging 1.00
R6132:Oacyl UTSW 18 65726355 missense probably damaging 1.00
R6367:Oacyl UTSW 18 65725444 missense probably damaging 1.00
R7009:Oacyl UTSW 18 65722538 nonsense probably null
R7097:Oacyl UTSW 18 65720252 missense probably benign 0.00
R7122:Oacyl UTSW 18 65720252 missense probably benign 0.00
R7132:Oacyl UTSW 18 65698409 missense probably damaging 1.00
R7260:Oacyl UTSW 18 65698367 missense probably damaging 1.00
R7403:Oacyl UTSW 18 65737895 missense probably benign 0.15
R7501:Oacyl UTSW 18 65725298 splice site probably null
R7759:Oacyl UTSW 18 65710560 missense probably damaging 1.00
R7892:Oacyl UTSW 18 65737847 missense probably benign 0.00
R7921:Oacyl UTSW 18 65725383 missense probably benign
R7977:Oacyl UTSW 18 65698391 missense probably benign 0.18
R7987:Oacyl UTSW 18 65698391 missense probably benign 0.18
Z1177:Oacyl UTSW 18 65725347 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GTTCAAAGGTCAGGTATGAGAGCCC -3'
(R):5'- GGAACCTTGGCATATGAGGTCACAC -3'

Sequencing Primer
(F):5'- CAGTACAGGTTTTGATTGAGCATCC -3'
(R):5'- CTCAGCATGTCTCTAGAACAGAAGG -3'
Posted On2014-01-05