Incidental Mutation 'R1139:4931408C20Rik'
ID95335
Institutional Source Beutler Lab
Gene Symbol 4931408C20Rik
Ensembl Gene ENSMUSG00000073722
Gene NameRIKEN cDNA 4931408C20 gene
Synonyms
MMRRC Submission 039212-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1139 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location26681814-26687460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 26682665 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 1145 (I1145L)
Ref Sequence ENSEMBL: ENSMUSP00000095410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097801]
Predicted Effect probably benign
Transcript: ENSMUST00000097801
AA Change: I1145L

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000095410
Gene: ENSMUSG00000073722
AA Change: I1145L

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:FAM75 128 474 4.6e-28 PFAM
internal_repeat_1 939 1112 4.27e-16 PROSPERO
internal_repeat_1 1204 1376 4.27e-16 PROSPERO
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G A 11: 58,288,286 V149M probably damaging Het
Abcc4 A G 14: 118,500,840 M1166T possibly damaging Het
Adgra3 A T 5: 49,961,755 probably null Het
Alox12b A T 11: 69,164,405 Q334L probably damaging Het
Bod1l A T 5: 41,831,471 M431K possibly damaging Het
Ckap5 A G 2: 91,581,143 N966D probably benign Het
Csmd3 C G 15: 47,695,836 D2240H probably damaging Het
Erbin A G 13: 103,884,253 F66S probably damaging Het
Mrgprh A T 17: 12,876,942 N23I probably benign Het
Mst1r G T 9: 107,919,969 D1346Y possibly damaging Het
Nfe2l2 A G 2: 75,676,886 M290T probably benign Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Olfr659 A G 7: 104,670,891 Y63C probably damaging Het
Olfr681 A G 7: 105,121,973 Y172C probably damaging Het
Olfr827 T C 10: 130,211,079 H17R possibly damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Rpgrip1 A C 14: 52,147,221 E757D probably benign Het
Scn9a T G 2: 66,504,997 K1207T probably benign Het
Ssb A G 2: 69,866,576 T87A possibly damaging Het
Tfdp1 C T 8: 13,373,000 R302C probably benign Het
Thbs4 T C 13: 92,774,718 Y319C probably damaging Het
Tiam2 C A 17: 3,477,267 Q67K possibly damaging Het
Tox3 A G 8: 90,248,869 L378P probably damaging Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Vcpip1 A T 1: 9,746,723 H478Q probably damaging Het
Vmn2r124 T C 17: 18,073,790 I713T possibly damaging Het
Other mutations in 4931408C20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:4931408C20Rik APN 1 26684977 missense probably benign 0.00
IGL00575:4931408C20Rik APN 1 26682932 missense possibly damaging 0.51
IGL00656:4931408C20Rik APN 1 26682901 missense possibly damaging 0.71
IGL00671:4931408C20Rik APN 1 26684859 missense possibly damaging 0.50
IGL00777:4931408C20Rik APN 1 26682092 missense probably damaging 1.00
IGL00824:4931408C20Rik APN 1 26683589 missense possibly damaging 0.48
IGL01018:4931408C20Rik APN 1 26682910 missense probably damaging 0.99
IGL01148:4931408C20Rik APN 1 26685172 missense probably benign 0.22
IGL01631:4931408C20Rik APN 1 26685414 missense probably damaging 0.98
IGL01901:4931408C20Rik APN 1 26682584 missense probably benign 0.13
IGL01957:4931408C20Rik APN 1 26685259 missense probably damaging 0.98
IGL02031:4931408C20Rik APN 1 26685023 missense probably damaging 0.99
IGL02596:4931408C20Rik APN 1 26684002 missense probably benign 0.00
PIT4486001:4931408C20Rik UTSW 1 26685329 missense probably damaging 0.99
R0026:4931408C20Rik UTSW 1 26683369 missense probably benign 0.00
R0026:4931408C20Rik UTSW 1 26683369 missense probably benign 0.00
R0043:4931408C20Rik UTSW 1 26683802 missense possibly damaging 0.72
R0141:4931408C20Rik UTSW 1 26683782 missense probably benign 0.00
R0145:4931408C20Rik UTSW 1 26687332 missense probably benign 0.00
R0158:4931408C20Rik UTSW 1 26683951 missense probably damaging 0.98
R0325:4931408C20Rik UTSW 1 26685266 missense possibly damaging 0.91
R0627:4931408C20Rik UTSW 1 26685889 missense probably benign 0.00
R0733:4931408C20Rik UTSW 1 26682932 missense possibly damaging 0.51
R1033:4931408C20Rik UTSW 1 26682385 missense probably benign
R1074:4931408C20Rik UTSW 1 26683226 missense probably benign 0.00
R1108:4931408C20Rik UTSW 1 26682466 missense possibly damaging 0.85
R1326:4931408C20Rik UTSW 1 26683930 missense probably damaging 1.00
R1398:4931408C20Rik UTSW 1 26685341 missense possibly damaging 0.82
R1422:4931408C20Rik UTSW 1 26682466 missense possibly damaging 0.85
R1463:4931408C20Rik UTSW 1 26682141 nonsense probably null
R1485:4931408C20Rik UTSW 1 26685880 missense possibly damaging 0.92
R1568:4931408C20Rik UTSW 1 26685869 missense probably benign 0.01
R1603:4931408C20Rik UTSW 1 26685569 missense probably damaging 0.99
R1605:4931408C20Rik UTSW 1 26684430 missense possibly damaging 0.92
R1795:4931408C20Rik UTSW 1 26682989 nonsense probably null
R1945:4931408C20Rik UTSW 1 26682314 missense probably benign 0.04
R1967:4931408C20Rik UTSW 1 26683373 missense probably benign 0.02
R2055:4931408C20Rik UTSW 1 26685732 missense possibly damaging 0.86
R2093:4931408C20Rik UTSW 1 26682141 nonsense probably null
R2131:4931408C20Rik UTSW 1 26685854 missense probably benign 0.11
R2237:4931408C20Rik UTSW 1 26685160 missense possibly damaging 0.82
R2314:4931408C20Rik UTSW 1 26684702 missense probably benign 0.00
R2407:4931408C20Rik UTSW 1 26682838 missense possibly damaging 0.86
R2993:4931408C20Rik UTSW 1 26685828 missense possibly damaging 0.83
R4245:4931408C20Rik UTSW 1 26682080 missense probably benign 0.00
R4567:4931408C20Rik UTSW 1 26683117 missense probably benign
R4605:4931408C20Rik UTSW 1 26683186 missense probably benign 0.45
R4708:4931408C20Rik UTSW 1 26684440 missense possibly damaging 0.92
R4827:4931408C20Rik UTSW 1 26685842 missense possibly damaging 0.91
R4839:4931408C20Rik UTSW 1 26685359 missense probably benign 0.11
R4888:4931408C20Rik UTSW 1 26683547 missense probably benign 0.00
R5075:4931408C20Rik UTSW 1 26683052 missense probably damaging 0.99
R5101:4931408C20Rik UTSW 1 26683336 missense possibly damaging 0.92
R5231:4931408C20Rik UTSW 1 26683951 missense possibly damaging 0.79
R5310:4931408C20Rik UTSW 1 26685088 missense probably benign 0.00
R5459:4931408C20Rik UTSW 1 26685191 missense probably damaging 0.96
R5520:4931408C20Rik UTSW 1 26685819 missense probably benign 0.00
R5608:4931408C20Rik UTSW 1 26683048 missense probably damaging 0.97
R5960:4931408C20Rik UTSW 1 26683144 missense probably benign 0.34
R6128:4931408C20Rik UTSW 1 26685425 missense probably benign 0.38
R6188:4931408C20Rik UTSW 1 26685703 missense probably damaging 0.99
R6319:4931408C20Rik UTSW 1 26685401 missense probably benign 0.38
R6339:4931408C20Rik UTSW 1 26682505 missense probably benign 0.01
R6431:4931408C20Rik UTSW 1 26684030 missense probably benign 0.11
R6456:4931408C20Rik UTSW 1 26685169 missense probably damaging 0.99
R6562:4931408C20Rik UTSW 1 26682362 missense possibly damaging 0.91
R6645:4931408C20Rik UTSW 1 26683117 missense probably benign 0.06
R6647:4931408C20Rik UTSW 1 26682578 missense probably damaging 0.99
R6919:4931408C20Rik UTSW 1 26682934 missense probably benign 0.15
R7085:4931408C20Rik UTSW 1 26683465 missense possibly damaging 0.95
R7183:4931408C20Rik UTSW 1 26682833 missense probably benign 0.27
R7347:4931408C20Rik UTSW 1 26684467 missense probably benign 0.02
R7488:4931408C20Rik UTSW 1 26683958 missense possibly damaging 0.77
R7565:4931408C20Rik UTSW 1 26685270 missense probably benign 0.00
R7726:4931408C20Rik UTSW 1 26684498 missense probably benign 0.08
X0025:4931408C20Rik UTSW 1 26682505 missense probably benign 0.00
X0061:4931408C20Rik UTSW 1 26682569 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TGGTCATCAAGCCCTAACTGCTGC -3'
(R):5'- GGGGCACAAGCACTCATTCAGATAC -3'

Sequencing Primer
(F):5'- AGCCCTAACTGCTGCTTGTC -3'
(R):5'- GCCAGTTGTTGACCAGAAAATC -3'
Posted On2014-01-05