Incidental Mutation 'R1139:Ssb'
ID95345
Institutional Source Beutler Lab
Gene Symbol Ssb
Ensembl Gene ENSMUSG00000068882
Gene NameSjogren syndrome antigen B
SynonymsSS-B, autoantigen La, La protein
MMRRC Submission 039212-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1139 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location69861562-69871846 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69866576 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 87 (T87A)
Ref Sequence ENSEMBL: ENSMUSP00000130313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060447] [ENSMUST00000090852] [ENSMUST00000112260] [ENSMUST00000132186] [ENSMUST00000142127] [ENSMUST00000166411]
Predicted Effect probably benign
Transcript: ENSMUST00000060447
SMART Domains Protein: ENSMUSP00000050907
Gene: ENSMUSG00000051730

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
Pfam:Cons_hypoth95 21 184 1.8e-12 PFAM
Pfam:UPF0020 25 170 3.8e-8 PFAM
Pfam:PrmA 35 127 8.4e-14 PFAM
Pfam:MTS 36 174 2.2e-16 PFAM
Pfam:Methyltransf_31 49 199 4e-15 PFAM
Pfam:Methyltransf_18 51 171 8.1e-11 PFAM
Pfam:Methyltransf_15 52 179 1.1e-9 PFAM
Pfam:Methyltransf_26 52 182 3.9e-8 PFAM
Pfam:Methyltransf_25 55 171 5.2e-8 PFAM
Pfam:Methyltransf_11 56 131 8e-6 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000090852
AA Change: T87A

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000088365
Gene: ENSMUSG00000068882
AA Change: T87A

DomainStartEndE-ValueType
LA 11 92 2.19e-42 SMART
RRM 112 183 1.6e-4 SMART
Pfam:RRM_3 230 333 2.2e-32 PFAM
low complexity region 375 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112260
AA Change: T87A

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000107879
Gene: ENSMUSG00000068882
AA Change: T87A

DomainStartEndE-ValueType
LA 11 92 2.19e-42 SMART
RRM 112 183 1.6e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132186
AA Change: T87A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000119773
Gene: ENSMUSG00000068882
AA Change: T87A

DomainStartEndE-ValueType
LA 11 92 2.19e-42 SMART
Pfam:RRM_1 113 154 2.6e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132603
SMART Domains Protein: ENSMUSP00000115666
Gene: ENSMUSG00000068882

DomainStartEndE-ValueType
Pfam:RRM_3 46 149 2.5e-33 PFAM
low complexity region 190 201 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135459
Predicted Effect probably benign
Transcript: ENSMUST00000142127
SMART Domains Protein: ENSMUSP00000121474
Gene: ENSMUSG00000051730

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
Pfam:Cons_hypoth95 21 141 8.7e-12 PFAM
Pfam:UPF0020 24 141 1.4e-11 PFAM
Pfam:Methyltransf_16 31 126 5e-7 PFAM
Pfam:PrmA 34 127 4e-15 PFAM
Pfam:MTS 35 141 1.4e-17 PFAM
Pfam:Methyltransf_31 49 142 5.2e-15 PFAM
Pfam:Methyltransf_18 51 141 1.4e-11 PFAM
Pfam:Methyltransf_15 52 140 4.5e-9 PFAM
Pfam:Methyltransf_26 52 140 1.3e-14 PFAM
Pfam:Methyltransf_25 55 142 4.7e-8 PFAM
Pfam:Methyltransf_11 56 134 3.8e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156057
Predicted Effect possibly damaging
Transcript: ENSMUST00000166411
AA Change: T87A

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000130313
Gene: ENSMUSG00000068882
AA Change: T87A

DomainStartEndE-ValueType
LA 11 92 2.19e-42 SMART
RRM 112 183 1.6e-4 SMART
Pfam:RRM_3 230 333 1.9e-35 PFAM
low complexity region 375 386 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in diverse aspects of RNA metabolism, including binding and protecting poly(U) termini of nascent RNA polymerase III transcripts from exonuclease digestion, processing 5' and 3' ends of pre-tRNA precursors, acting as an RNA chaperone, and binding viral RNAs associated with hepatitis C virus. Autoantibodies reacting with this protein are found in the sera of patients with Sjogren syndrome and systemic lupus erythematosus. Alternative promoter usage results in two different transcript variants which encode the same protein. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos, possible before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G A 11: 58,288,286 V149M probably damaging Het
4931408C20Rik T G 1: 26,682,665 I1145L probably benign Het
Abcc4 A G 14: 118,500,840 M1166T possibly damaging Het
Adgra3 A T 5: 49,961,755 probably null Het
Alox12b A T 11: 69,164,405 Q334L probably damaging Het
Bod1l A T 5: 41,831,471 M431K possibly damaging Het
Ckap5 A G 2: 91,581,143 N966D probably benign Het
Csmd3 C G 15: 47,695,836 D2240H probably damaging Het
Erbin A G 13: 103,884,253 F66S probably damaging Het
Mrgprh A T 17: 12,876,942 N23I probably benign Het
Mst1r G T 9: 107,919,969 D1346Y possibly damaging Het
Nfe2l2 A G 2: 75,676,886 M290T probably benign Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Olfr659 A G 7: 104,670,891 Y63C probably damaging Het
Olfr681 A G 7: 105,121,973 Y172C probably damaging Het
Olfr827 T C 10: 130,211,079 H17R possibly damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Rpgrip1 A C 14: 52,147,221 E757D probably benign Het
Scn9a T G 2: 66,504,997 K1207T probably benign Het
Tfdp1 C T 8: 13,373,000 R302C probably benign Het
Thbs4 T C 13: 92,774,718 Y319C probably damaging Het
Tiam2 C A 17: 3,477,267 Q67K possibly damaging Het
Tox3 A G 8: 90,248,869 L378P probably damaging Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Vcpip1 A T 1: 9,746,723 H478Q probably damaging Het
Vmn2r124 T C 17: 18,073,790 I713T possibly damaging Het
Other mutations in Ssb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Ssb APN 2 69866262 missense probably benign 0.06
IGL00940:Ssb APN 2 69870835 critical splice donor site probably null
IGL00941:Ssb APN 2 69870835 critical splice donor site probably null
IGL01834:Ssb APN 2 69870803 missense possibly damaging 0.89
R0713:Ssb UTSW 2 69867359 missense probably benign 0.06
R0716:Ssb UTSW 2 69867359 missense probably benign 0.06
R0751:Ssb UTSW 2 69870565 missense probably benign
R1928:Ssb UTSW 2 69867557 splice site probably null
R2037:Ssb UTSW 2 69868819 missense probably benign 0.16
R3968:Ssb UTSW 2 69867449 splice site probably benign
R4674:Ssb UTSW 2 69868850 missense probably benign 0.01
R5039:Ssb UTSW 2 69866237 missense possibly damaging 0.79
R5551:Ssb UTSW 2 69871130 missense probably damaging 0.99
R6102:Ssb UTSW 2 69871208 makesense probably null
R7126:Ssb UTSW 2 69866501 missense possibly damaging 0.70
R7448:Ssb UTSW 2 69863280 missense probably benign
R7590:Ssb UTSW 2 69867290 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TGGAGACTTCAATTTGCCACGAGAC -3'
(R):5'- GGCCAAATGTGATCCCTGAGCAT -3'

Sequencing Primer
(F):5'- CATTGAATTACCTTAGTTTTGCGGC -3'
(R):5'- agccaggactatacagagaaac -3'
Posted On2014-01-05