Mutagenetix > Incidental Mutation

Incidental Mutation 'R1034:Tns1'

95360

Institutional Source

Beutler Lab

Gene Symbol

Tns1

Ensembl Gene

ENSMUSG00000055322

Gene Name

tensin 1

Synonyms

1110018I21Rik, 1200014E20Rik, E030018G17Rik, E030037J05Rik, Tns

MMRRC Submission

039133-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.496) question?

Stock #

R1034 (G1)

Quality Score

Status

Not validated

Chromosome

Chromosomal Location

73910231-74124449 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 73941969 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 1079 (C1079R)

Ref Sequence

ENSEMBL: ENSMUSP00000148638 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169786] [ENSMUST00000187584] [ENSMUST00000191104] [ENSMUST00000212888]

AlphaFold

E9Q0S6

Predicted Effect

probably damaging
Transcript: ENSMUST00000169786
AA Change: C1079R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000127715
Gene: ENSMUSG00000055322
AA Change: C1079R

Domain	Start	End	E-Value	Type
low complexity region	15	33	N/A	INTRINSIC
C1	62	108	1.77e-2	SMART
low complexity region	154	167	N/A	INTRINSIC
SCOP:d1d5ra2	176	348	3e-32	SMART
PTEN_C2	350	477	1.12e-51	SMART
low complexity region	822	833	N/A	INTRINSIC
low complexity region	905	922	N/A	INTRINSIC
low complexity region	1227	1239	N/A	INTRINSIC
low complexity region	1284	1300	N/A	INTRINSIC
low complexity region	1459	1470	N/A	INTRINSIC
low complexity region	1518	1530	N/A	INTRINSIC
SH2	1614	1716	6.85e-17	SMART
PTB	1747	1888	1.69e-29	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000185331
AA Change: C909R

Predicted Effect

unknown
Transcript: ENSMUST00000185702
AA Change: C909R

Predicted Effect

probably damaging
Transcript: ENSMUST00000187584
AA Change: C1035R

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000140254
Gene: ENSMUSG00000055322
AA Change: C1035R

Domain	Start	End	E-Value	Type
C1	21	67	8.6e-5	SMART
low complexity region	113	124	N/A	INTRINSIC
PTPc_DSPc	197	319	9.9e-6	SMART
PTEN_C2	306	433	5.6e-56	SMART
low complexity region	778	789	N/A	INTRINSIC
low complexity region	861	878	N/A	INTRINSIC
low complexity region	1162	1174	N/A	INTRINSIC
low complexity region	1219	1235	N/A	INTRINSIC
low complexity region	1394	1405	N/A	INTRINSIC
low complexity region	1453	1465	N/A	INTRINSIC
SH2	1549	1651	4.3e-19	SMART
PTB	1682	1823	9e-32	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000189228

Predicted Effect

probably damaging
Transcript: ENSMUST00000191104
AA Change: C1079R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000140317
Gene: ENSMUSG00000055322
AA Change: C1079R

Domain	Start	End	E-Value	Type
low complexity region	15	33	N/A	INTRINSIC
C1	62	108	8.6e-5	SMART
low complexity region	154	167	N/A	INTRINSIC
PTPc_DSPc	241	363	9.9e-6	SMART
PTEN_C2	350	477	5.6e-56	SMART
low complexity region	822	833	N/A	INTRINSIC
low complexity region	905	922	N/A	INTRINSIC
low complexity region	1206	1218	N/A	INTRINSIC
low complexity region	1263	1279	N/A	INTRINSIC
low complexity region	1438	1449	N/A	INTRINSIC
low complexity region	1497	1509	N/A	INTRINSIC
SH2	1593	1695	4.3e-19	SMART
PTB	1726	1867	9e-32	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000212888
AA Change: C1079R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Coding Region Coverage

1x: 98.7%
3x: 97.3%
10x: 92.9%
20x: 82.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to focal adhesions, regions of the plasma membrane where the cell attaches to the extracellular matrix. This protein crosslinks actin filaments and contains a Src homology 2 (SH2) domain, which is often found in molecules involved in signal transduction. This protein is a substrate of calpain II. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced female fertility, and develop kidney cysts and progressive kidney degeneration that may lead to death from renal failure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	G	A	5: 76,876,283	T174M	probably damaging	Het
Abca14	T	C	7: 120,216,147	F206S	probably damaging	Het
Arid2	T	C	15: 96,369,505	V622A	probably benign	Het
Asic1	T	A	15: 99,698,058	L437Q	probably damaging	Het
Atp1b1	C	T	1: 164,453,488		probably null	Het
B3gnt5	A	G	16: 19,769,484	Y151C	probably damaging	Het
Cbx4	A	G	11: 119,081,707	S281P	probably damaging	Het
Dnah5	G	A	15: 28,302,471	V1625I	probably damaging	Het
Eftud2	A	C	11: 102,849,184	D461E	probably benign	Het
Epgn	A	G	5: 91,032,221	Y74C	probably damaging	Het
Fcho1	C	T	8: 71,712,560	A418T	probably benign	Het
Fgf14	C	T	14: 124,132,534	V113I	probably damaging	Het
Ggcx	G	A	6: 72,414,831	R68H	probably damaging	Het
Gm1110	A	G	9: 26,921,350	S16P	probably damaging	Het
Gm6729	T	C	10: 86,540,026		noncoding transcript	Het
Gpr108	A	G	17: 57,235,995	F522S	probably damaging	Het
Gpr156	T	C	16: 38,004,726	V435A	probably benign	Het
Khdrbs2	T	C	1: 32,467,791	L172P	probably damaging	Het
Kmo	C	T	1: 175,651,618	P240L	possibly damaging	Het
Ltn1	A	T	16: 87,397,137		probably null	Het
Nbeal1	T	A	1: 60,290,006	Y2194*	probably null	Het
Olfr767	T	A	10: 129,079,961	M1L	probably benign	Het
Olfr867	A	T	9: 20,055,365	S33T	probably benign	Het
Rab6b	T	C	9: 103,167,124	S172P	probably benign	Het
Ror1	T	A	4: 100,333,620	L58*	probably null	Het
Sec23b	A	G	2: 144,590,338	D756G	possibly damaging	Het
Slc24a2	T	A	4: 87,032,275	K428N	probably damaging	Het
Spen	C	A	4: 141,475,752	V1855L	probably benign	Het
Srgap1	G	A	10: 121,785,445	P1071S	possibly damaging	Het
Traf3ip1	G	T	1: 91,518,319		probably null	Het
Trmt2a	T	C	16: 18,249,709	F82S	probably damaging	Het
Xrn1	A	G	9: 96,039,737	D1401G	probably damaging	Het
Zfp352	T	A	4: 90,224,156	S178T	possibly damaging	Het
Zfp758	G	T	17: 22,375,759	E409*	probably null	Het

Other mutations in Tns1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00954:Tns1	APN	1	73924969	missense	probably damaging	0.99
IGL01288:Tns1	APN	1	73953810	missense	probably damaging	1.00
IGL01536:Tns1	APN	1	73919648	splice site	probably benign
IGL01568:Tns1	APN	1	73953509	missense	probably damaging	1.00
IGL01683:Tns1	APN	1	73953269	missense	probably damaging	0.98
IGL02267:Tns1	APN	1	73992131	missense	possibly damaging	0.95
IGL02597:Tns1	APN	1	73985873	critical splice donor site	probably null
IGL02819:Tns1	APN	1	73937248	missense	probably damaging	0.99
IGL03370:Tns1	APN	1	73985894	missense	probably damaging	1.00
R0087:Tns1	UTSW	1	73916917	missense	possibly damaging	0.95
R0207:Tns1	UTSW	1	73937318	critical splice acceptor site	probably null
R0411:Tns1	UTSW	1	73925761	missense	probably damaging	0.96
R0543:Tns1	UTSW	1	73952697	missense	probably benign	0.01
R0552:Tns1	UTSW	1	73920563	missense	probably damaging	1.00
R0720:Tns1	UTSW	1	73925581	missense	probably benign	0.03
R0828:Tns1	UTSW	1	73919666	missense	probably damaging	1.00
R1061:Tns1	UTSW	1	73917672	missense	probably damaging	1.00
R1819:Tns1	UTSW	1	73916476	splice site	probably benign
R1826:Tns1	UTSW	1	73953634	start codon destroyed	probably null	0.91
R2208:Tns1	UTSW	1	74079240	missense	probably damaging	1.00
R3723:Tns1	UTSW	1	73924940	missense	probably damaging	0.99
R4079:Tns1	UTSW	1	73995308	missense	probably damaging	1.00
R4111:Tns1	UTSW	1	73941932	missense	probably damaging	1.00
R4155:Tns1	UTSW	1	73914631	missense	probably damaging	1.00
R4156:Tns1	UTSW	1	73914631	missense	probably damaging	1.00
R4157:Tns1	UTSW	1	73914631	missense	probably damaging	1.00
R4274:Tns1	UTSW	1	73928098	missense	probably damaging	1.00
R4426:Tns1	UTSW	1	73985749	missense	probably damaging	0.97
R4649:Tns1	UTSW	1	73953771	missense	probably damaging	1.00
R4742:Tns1	UTSW	1	74124290	critical splice donor site	probably null
R4869:Tns1	UTSW	1	73952615	missense	probably benign
R4961:Tns1	UTSW	1	73935915	missense	probably benign	0.35
R5025:Tns1	UTSW	1	73925482	missense	probably damaging	1.00
R5035:Tns1	UTSW	1	73953820	start gained	probably benign
R5062:Tns1	UTSW	1	73952864	missense	probably damaging	1.00
R5080:Tns1	UTSW	1	73952940	missense	probably damaging	1.00
R5213:Tns1	UTSW	1	73953612	missense	probably damaging	1.00
R5256:Tns1	UTSW	1	73995426	intron	probably benign
R5368:Tns1	UTSW	1	73941017	missense	probably benign	0.07
R5391:Tns1	UTSW	1	73990409	splice site	probably null
R5587:Tns1	UTSW	1	73920596	missense	possibly damaging	0.94
R5735:Tns1	UTSW	1	73927979	missense	probably benign	0.00
R5855:Tns1	UTSW	1	73918033	missense	possibly damaging	0.83
R5999:Tns1	UTSW	1	73928097	nonsense	probably null
R6122:Tns1	UTSW	1	73952419	critical splice donor site	probably null
R6148:Tns1	UTSW	1	73953453	missense	probably damaging	1.00
R6457:Tns1	UTSW	1	73918050	missense	probably damaging	0.99
R6525:Tns1	UTSW	1	73953470	missense	probably damaging	1.00
R6712:Tns1	UTSW	1	74079301	nonsense	probably null
R6773:Tns1	UTSW	1	73919707	missense	probably damaging	1.00
R6825:Tns1	UTSW	1	74002323	nonsense	probably null
R7085:Tns1	UTSW	1	73925462	missense	probably benign	0.00
R7128:Tns1	UTSW	1	73995304	missense
R7209:Tns1	UTSW	1	73953915	missense	possibly damaging	0.68
R7348:Tns1	UTSW	1	73916917	missense	possibly damaging	0.95
R7570:Tns1	UTSW	1	73953479	missense	probably damaging	1.00
R7670:Tns1	UTSW	1	73952477	missense	possibly damaging	0.93
R7769:Tns1	UTSW	1	73953371	missense	probably damaging	0.99
R7833:Tns1	UTSW	1	74091331	intron	probably benign
R8052:Tns1	UTSW	1	73953437	missense	probably damaging	1.00
R8225:Tns1	UTSW	1	73985887	missense	probably damaging	1.00
R8244:Tns1	UTSW	1	73937251	missense	probably damaging	1.00
R8321:Tns1	UTSW	1	73985780	critical splice acceptor site	probably null
R8344:Tns1	UTSW	1	73985042	missense	probably damaging	1.00
R8378:Tns1	UTSW	1	73937246	missense	probably damaging	1.00
R8434:Tns1	UTSW	1	73925606	missense	probably benign	0.00
R8773:Tns1	UTSW	1	73937248	missense	probably damaging	0.99
R9211:Tns1	UTSW	1	73917789	missense	possibly damaging	0.63
R9251:Tns1	UTSW	1	73991696	missense	probably damaging	1.00
R9315:Tns1	UTSW	1	73940982	missense
R9411:Tns1	UTSW	1	73953503	missense	probably damaging	1.00
R9592:Tns1	UTSW	1	73990394	missense	probably damaging	1.00
R9658:Tns1	UTSW	1	73942023	missense	probably benign	0.14
R9658:Tns1	UTSW	1	73942024	missense	probably benign	0.08
Z1177:Tns1	UTSW	1	74002307	missense	probably benign	0.12

Predicted Primers

PCR Primer
(F):5'- GTAACAGCACTTGACTCTCAGGCTC -3'
(R):5'- GCTCTCCGTCCAAATCCTATGCAG -3'

Sequencing Primer
(F):5'- ACTCTCAGGCTCCTGGAGATG -3'
(R):5'- TCCTATGCAGAGTAGAGACTCCTC -3'

Posted On

2014-01-05