Incidental Mutation 'R1034:Traf3ip1'
ID 95366
Institutional Source Beutler Lab
Gene Symbol Traf3ip1
Ensembl Gene ENSMUSG00000034292
Gene Name TRAF3 interacting protein 1
Synonyms MIP-T3, 3930402D05Rik
MMRRC Submission 039133-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1034 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 91422369-91457029 bp(+) (GRCm39)
Type of Mutation splice site (5 bp from exon)
DNA Base Change (assembly) G to T at 91446041 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047242] [ENSMUST00000189341] [ENSMUST00000189341]
AlphaFold Q149C2
Predicted Effect probably null
Transcript: ENSMUST00000047242
SMART Domains Protein: ENSMUSP00000042391
Gene: ENSMUSG00000034292

DomainStartEndE-ValueType
Pfam:MIP-T3 49 619 7e-207 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187588
Predicted Effect probably null
Transcript: ENSMUST00000189341
SMART Domains Protein: ENSMUSP00000140151
Gene: ENSMUSG00000034292

DomainStartEndE-ValueType
Pfam:MIP-T3 49 648 7.1e-203 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000189341
SMART Domains Protein: ENSMUSP00000140151
Gene: ENSMUSG00000034292

DomainStartEndE-ValueType
Pfam:MIP-T3 49 648 7.1e-203 PFAM
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.3%
  • 10x: 92.9%
  • 20x: 82.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality, cardiac edema, abnormal neural development, polydactyly, and microphthalmia associated with a lack of embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 77,024,130 (GRCm39) T174M probably damaging Het
Abca14 T C 7: 119,815,370 (GRCm39) F206S probably damaging Het
Arid2 T C 15: 96,267,386 (GRCm39) V622A probably benign Het
Asic1 T A 15: 99,595,939 (GRCm39) L437Q probably damaging Het
Atp1b1 C T 1: 164,281,057 (GRCm39) probably null Het
B3gnt5 A G 16: 19,588,234 (GRCm39) Y151C probably damaging Het
Cbx4 A G 11: 118,972,533 (GRCm39) S281P probably damaging Het
Dnah5 G A 15: 28,302,617 (GRCm39) V1625I probably damaging Het
Eftud2 A C 11: 102,740,010 (GRCm39) D461E probably benign Het
Epgn A G 5: 91,180,080 (GRCm39) Y74C probably damaging Het
Fcho1 C T 8: 72,165,204 (GRCm39) A418T probably benign Het
Fgf14 C T 14: 124,369,946 (GRCm39) V113I probably damaging Het
Ggcx G A 6: 72,391,814 (GRCm39) R68H probably damaging Het
Gm1110 A G 9: 26,832,646 (GRCm39) S16P probably damaging Het
Gm6729 T C 10: 86,375,890 (GRCm39) noncoding transcript Het
Gpr108 A G 17: 57,542,995 (GRCm39) F522S probably damaging Het
Gpr156 T C 16: 37,825,088 (GRCm39) V435A probably benign Het
Khdrbs2 T C 1: 32,506,872 (GRCm39) L172P probably damaging Het
Kmo C T 1: 175,479,184 (GRCm39) P240L possibly damaging Het
Ltn1 A T 16: 87,194,025 (GRCm39) probably null Het
Nbeal1 T A 1: 60,329,165 (GRCm39) Y2194* probably null Het
Or6c8 T A 10: 128,915,830 (GRCm39) M1L probably benign Het
Or7d11 A T 9: 19,966,661 (GRCm39) S33T probably benign Het
Rab6b T C 9: 103,044,323 (GRCm39) S172P probably benign Het
Ror1 T A 4: 100,190,817 (GRCm39) L58* probably null Het
Sec23b A G 2: 144,432,258 (GRCm39) D756G possibly damaging Het
Slc24a2 T A 4: 86,950,512 (GRCm39) K428N probably damaging Het
Spen C A 4: 141,203,063 (GRCm39) V1855L probably benign Het
Srgap1 G A 10: 121,621,350 (GRCm39) P1071S possibly damaging Het
Tns1 A G 1: 73,981,128 (GRCm39) C1079R probably damaging Het
Trmt2a T C 16: 18,067,573 (GRCm39) F82S probably damaging Het
Xrn1 A G 9: 95,921,790 (GRCm39) D1401G probably damaging Het
Zfp352 T A 4: 90,112,393 (GRCm39) S178T possibly damaging Het
Zfp758 G T 17: 22,594,740 (GRCm39) E409* probably null Het
Other mutations in Traf3ip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01355:Traf3ip1 APN 1 91,446,019 (GRCm39) missense probably damaging 0.98
IGL01997:Traf3ip1 APN 1 91,435,292 (GRCm39) critical splice donor site probably null
IGL02431:Traf3ip1 APN 1 91,427,357 (GRCm39) missense unknown
IGL03106:Traf3ip1 APN 1 91,450,609 (GRCm39) missense probably benign 0.26
eclectic UTSW 1 91,435,458 (GRCm39) splice site probably null
R0538:Traf3ip1 UTSW 1 91,427,341 (GRCm39) missense unknown
R1065:Traf3ip1 UTSW 1 91,428,506 (GRCm39) missense unknown
R1757:Traf3ip1 UTSW 1 91,450,579 (GRCm39) missense probably damaging 1.00
R2360:Traf3ip1 UTSW 1 91,427,374 (GRCm39) missense unknown
R2367:Traf3ip1 UTSW 1 91,435,242 (GRCm39) missense possibly damaging 0.90
R3031:Traf3ip1 UTSW 1 91,447,822 (GRCm39) missense probably damaging 1.00
R3752:Traf3ip1 UTSW 1 91,446,019 (GRCm39) missense probably damaging 0.98
R3752:Traf3ip1 UTSW 1 91,428,639 (GRCm39) splice site probably benign
R4690:Traf3ip1 UTSW 1 91,447,834 (GRCm39) missense possibly damaging 0.90
R4747:Traf3ip1 UTSW 1 91,455,479 (GRCm39) missense probably damaging 1.00
R5328:Traf3ip1 UTSW 1 91,447,791 (GRCm39) missense probably damaging 1.00
R5540:Traf3ip1 UTSW 1 91,429,037 (GRCm39) missense probably benign 0.07
R5910:Traf3ip1 UTSW 1 91,455,467 (GRCm39) missense probably damaging 1.00
R6593:Traf3ip1 UTSW 1 91,455,417 (GRCm39) missense possibly damaging 0.82
R6836:Traf3ip1 UTSW 1 91,448,722 (GRCm39) missense probably benign 0.17
R7249:Traf3ip1 UTSW 1 91,455,361 (GRCm39) missense probably damaging 1.00
R7418:Traf3ip1 UTSW 1 91,435,458 (GRCm39) splice site probably null
R7436:Traf3ip1 UTSW 1 91,439,110 (GRCm39) missense probably benign 0.02
R7597:Traf3ip1 UTSW 1 91,439,167 (GRCm39) missense probably damaging 0.97
R7751:Traf3ip1 UTSW 1 91,422,479 (GRCm39) start gained probably benign
R8031:Traf3ip1 UTSW 1 91,429,141 (GRCm39) missense probably damaging 1.00
R8179:Traf3ip1 UTSW 1 91,428,523 (GRCm39) missense unknown
R8919:Traf3ip1 UTSW 1 91,443,796 (GRCm39) intron probably benign
R9002:Traf3ip1 UTSW 1 91,433,178 (GRCm39) missense probably benign 0.05
R9040:Traf3ip1 UTSW 1 91,429,092 (GRCm39) missense probably damaging 0.99
R9055:Traf3ip1 UTSW 1 91,428,733 (GRCm39) nonsense probably null
R9745:Traf3ip1 UTSW 1 91,439,095 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGGCGTAGGTAGTCCTTCACATTC -3'
(R):5'- TGTGTATGGCCCACATACAAAATGGAA -3'

Sequencing Primer
(F):5'- agcctgtctctgcctcc -3'
(R):5'- tggaaacttaaaacacagcaaaatag -3'
Posted On 2014-01-05