Incidental Mutation 'R1034:Atp1b1'
ID 95370
Institutional Source Beutler Lab
Gene Symbol Atp1b1
Ensembl Gene ENSMUSG00000026576
Gene Name ATPase, Na+/K+ transporting, beta 1 polypeptide
Synonyms Atpb, Atpb-1, sodium/potassium ATPase beta subunit
MMRRC Submission 039133-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.677) question?
Stock # R1034 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 164437109-164458355 bp(-) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 164453488 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027863] [ENSMUST00000193367]
AlphaFold P14094
Predicted Effect probably null
Transcript: ENSMUST00000027863
SMART Domains Protein: ENSMUSP00000027863
Gene: ENSMUSG00000026576

DomainStartEndE-ValueType
Pfam:Na_K-ATPase 3 298 1.1e-100 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192522
Predicted Effect probably null
Transcript: ENSMUST00000193367
SMART Domains Protein: ENSMUSP00000141777
Gene: ENSMUSG00000026576

DomainStartEndE-ValueType
Pfam:Na_K-ATPase 1 132 2.7e-48 PFAM
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.3%
  • 10x: 92.9%
  • 20x: 82.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an integral membrane protein that comprises a subunit of an ATP-metabolizing enzyme responsible for transporting sodium and potassium ions across the plasma membrane. This enzyme regulates the electrochemical gradient of these ions in cells, and plays a central role in osmoregulation and signal transmission in nerves and muscles, among other biological processes. The encoded protein is the non-catalytic beta subunit; it works together with a catalytic alpha subunit and a gamma subunit. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a conditional allele activated in cardiac tissue exhibit age-related cardiac hypertrophy and reduced cardiac function, insensitivity to ouabain, and increased heart dysfunction following aortic constriction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Abca14 T C 7: 120,216,147 F206S probably damaging Het
Arid2 T C 15: 96,369,505 V622A probably benign Het
Asic1 T A 15: 99,698,058 L437Q probably damaging Het
B3gnt5 A G 16: 19,769,484 Y151C probably damaging Het
Cbx4 A G 11: 119,081,707 S281P probably damaging Het
Dnah5 G A 15: 28,302,471 V1625I probably damaging Het
Eftud2 A C 11: 102,849,184 D461E probably benign Het
Epgn A G 5: 91,032,221 Y74C probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fgf14 C T 14: 124,132,534 V113I probably damaging Het
Ggcx G A 6: 72,414,831 R68H probably damaging Het
Gm1110 A G 9: 26,921,350 S16P probably damaging Het
Gm6729 T C 10: 86,540,026 noncoding transcript Het
Gpr108 A G 17: 57,235,995 F522S probably damaging Het
Gpr156 T C 16: 38,004,726 V435A probably benign Het
Khdrbs2 T C 1: 32,467,791 L172P probably damaging Het
Kmo C T 1: 175,651,618 P240L possibly damaging Het
Ltn1 A T 16: 87,397,137 probably null Het
Nbeal1 T A 1: 60,290,006 Y2194* probably null Het
Olfr767 T A 10: 129,079,961 M1L probably benign Het
Olfr867 A T 9: 20,055,365 S33T probably benign Het
Rab6b T C 9: 103,167,124 S172P probably benign Het
Ror1 T A 4: 100,333,620 L58* probably null Het
Sec23b A G 2: 144,590,338 D756G possibly damaging Het
Slc24a2 T A 4: 87,032,275 K428N probably damaging Het
Spen C A 4: 141,475,752 V1855L probably benign Het
Srgap1 G A 10: 121,785,445 P1071S possibly damaging Het
Tns1 A G 1: 73,941,969 C1079R probably damaging Het
Traf3ip1 G T 1: 91,518,319 probably null Het
Trmt2a T C 16: 18,249,709 F82S probably damaging Het
Xrn1 A G 9: 96,039,737 D1401G probably damaging Het
Zfp352 T A 4: 90,224,156 S178T possibly damaging Het
Zfp758 G T 17: 22,375,759 E409* probably null Het
Other mutations in Atp1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01642:Atp1b1 APN 1 164457761 missense probably benign 0.34
IGL01801:Atp1b1 APN 1 164438349 missense probably damaging 1.00
R0941:Atp1b1 UTSW 1 164443260 missense probably benign
R1597:Atp1b1 UTSW 1 164438320 missense probably damaging 1.00
R2202:Atp1b1 UTSW 1 164453515 missense probably benign 0.01
R3811:Atp1b1 UTSW 1 164443305 missense probably benign 0.00
R3817:Atp1b1 UTSW 1 164443305 missense probably benign 0.00
R3819:Atp1b1 UTSW 1 164443305 missense probably benign 0.00
R3880:Atp1b1 UTSW 1 164443305 missense probably benign 0.00
R4420:Atp1b1 UTSW 1 164453558 missense probably damaging 1.00
R4945:Atp1b1 UTSW 1 164438298 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAGAGCCAGAACGGCCCTAGAATG -3'
(R):5'- GGGATTTGATTCCGAGCCTGTGAC -3'

Sequencing Primer
(F):5'- GATGTGCTCCATCACACAGTG -3'
(R):5'- GATTCCGAGCCTGTGACTACATC -3'
Posted On 2014-01-05