Mutagenetix > Incidental Mutations

Incidental Mutation 'R1034:Kmo'

95372

Institutional Source

Beutler Lab

Gene Symbol

Kmo

Ensembl Gene

ENSMUSG00000039783

Gene Name

kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)

Synonyms

MMRRC Submission

039133-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1034 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

175620381-175662116 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 175651618 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 240 (P240L)

Ref Sequence

ENSEMBL: ENSMUSP00000095067 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040250] [ENSMUST00000097458] [ENSMUST00000140474]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000040250
AA Change: P240L

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000038914
Gene: ENSMUSG00000039783
AA Change: P240L

Domain	Start	End	E-Value	Type
Pfam:FAD_binding_3	9	328	5.6e-22	PFAM
Pfam:NAD_binding_8	13	63	2.2e-7	PFAM
transmembrane domain	425	447	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000097458
AA Change: P240L

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000095067
Gene: ENSMUSG00000039783
AA Change: P240L

Domain	Start	End	E-Value	Type
Pfam:FAD_binding_3	9	328	5.8e-22	PFAM
Pfam:NAD_binding_8	13	63	2.1e-7	PFAM
transmembrane domain	391	413	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137174

Predicted Effect

silent
Transcript: ENSMUST00000140474

SMART Domains

Protein: ENSMUSP00000122943
Gene: ENSMUSG00000039783

Domain	Start	End	E-Value	Type
Pfam:FAD_binding_3	44	240	2.9e-10	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142223

Meta Mutation Damage Score

0.9221

Coding Region Coverage

1x: 98.7%
3x: 97.3%
10x: 92.9%
20x: 82.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrion outer membrane protein that catalyzes the hydroxylation of L-tryptophan metabolite, L-kynurenine, to form L-3-hydroxykynurenine. Studies in yeast identified this gene as a therapeutic target for Huntington disease. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele lack kynurenine 3-monooxygenase activity and altered levels of several tryptophan metabolites. Mice homozygous for another null allele exhibit increased LPS-induced depressive behaviors and altered kynurenine metabolism. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	G	A	5: 76,876,283	T174M	probably damaging	Het
Abca14	T	C	7: 120,216,147	F206S	probably damaging	Het
Arid2	T	C	15: 96,369,505	V622A	probably benign	Het
Asic1	T	A	15: 99,698,058	L437Q	probably damaging	Het
Atp1b1	C	T	1: 164,453,488		probably null	Het
B3gnt5	A	G	16: 19,769,484	Y151C	probably damaging	Het
Cbx4	A	G	11: 119,081,707	S281P	probably damaging	Het
Dnah5	G	A	15: 28,302,471	V1625I	probably damaging	Het
Eftud2	A	C	11: 102,849,184	D461E	probably benign	Het
Epgn	A	G	5: 91,032,221	Y74C	probably damaging	Het
Fcho1	C	T	8: 71,712,560	A418T	probably benign	Het
Fgf14	C	T	14: 124,132,534	V113I	probably damaging	Het
Ggcx	G	A	6: 72,414,831	R68H	probably damaging	Het
Gm1110	A	G	9: 26,921,350	S16P	probably damaging	Het
Gm6729	T	C	10: 86,540,026		noncoding transcript	Het
Gpr108	A	G	17: 57,235,995	F522S	probably damaging	Het
Gpr156	T	C	16: 38,004,726	V435A	probably benign	Het
Khdrbs2	T	C	1: 32,467,791	L172P	probably damaging	Het
Ltn1	A	T	16: 87,397,137		probably null	Het
Nbeal1	T	A	1: 60,290,006	Y2194*	probably null	Het
Olfr767	T	A	10: 129,079,961	M1L	probably benign	Het
Olfr867	A	T	9: 20,055,365	S33T	probably benign	Het
Rab6b	T	C	9: 103,167,124	S172P	probably benign	Het
Ror1	T	A	4: 100,333,620	L58*	probably null	Het
Sec23b	A	G	2: 144,590,338	D756G	possibly damaging	Het
Slc24a2	T	A	4: 87,032,275	K428N	probably damaging	Het
Spen	C	A	4: 141,475,752	V1855L	probably benign	Het
Srgap1	G	A	10: 121,785,445	P1071S	possibly damaging	Het
Tns1	A	G	1: 73,941,969	C1079R	probably damaging	Het
Traf3ip1	G	T	1: 91,518,319		probably null	Het
Trmt2a	T	C	16: 18,249,709	F82S	probably damaging	Het
Xrn1	A	G	9: 96,039,737	D1401G	probably damaging	Het
Zfp352	T	A	4: 90,224,156	S178T	possibly damaging	Het
Zfp758	G	T	17: 22,375,759	E409*	probably null	Het

Other mutations in Kmo

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01400:Kmo	APN	1	175655095	missense	possibly damaging	0.54
IGL01734:Kmo	APN	1	175655102	missense	probably benign	0.00
IGL02415:Kmo	APN	1	175649323	splice site	probably benign
IGL02551:Kmo	APN	1	175637919	missense	probably damaging	1.00
IGL02866:Kmo	APN	1	175653588	missense	probably damaging	1.00
IGL03140:Kmo	APN	1	175649220	missense	probably damaging	1.00
R0613:Kmo	UTSW	1	175637892	missense	probably damaging	1.00
R0617:Kmo	UTSW	1	175647190	missense	possibly damaging	0.85
R0883:Kmo	UTSW	1	175647140	missense	possibly damaging	0.70
R1037:Kmo	UTSW	1	175651618	missense	possibly damaging	0.95
R1164:Kmo	UTSW	1	175658559	missense	probably benign	0.00
R1519:Kmo	UTSW	1	175651618	missense	possibly damaging	0.95
R1519:Kmo	UTSW	1	175656802	missense	probably damaging	1.00
R1712:Kmo	UTSW	1	175656723	missense	probably benign
R1796:Kmo	UTSW	1	175637895	missense	probably benign	0.00
R1938:Kmo	UTSW	1	175651588	missense	possibly damaging	0.88
R4531:Kmo	UTSW	1	175659707	splice site	probably null
R4586:Kmo	UTSW	1	175650572	missense	probably damaging	1.00
R4586:Kmo	UTSW	1	175650573	missense	possibly damaging	0.90
R4603:Kmo	UTSW	1	175651642	missense	probably benign	0.13
R4647:Kmo	UTSW	1	175659774	nonsense	probably null
R4728:Kmo	UTSW	1	175656763	missense	possibly damaging	0.51
R5569:Kmo	UTSW	1	175655122	missense	probably benign	0.04
R5571:Kmo	UTSW	1	175647194	missense	possibly damaging	0.46
R6109:Kmo	UTSW	1	175637908	missense	possibly damaging	0.67
R6244:Kmo	UTSW	1	175659695	missense	possibly damaging	0.91
R6943:Kmo	UTSW	1	175658375	missense	probably benign	0.00
R7148:Kmo	UTSW	1	175651602	missense	probably damaging	1.00
R7319:Kmo	UTSW	1	175653655	missense	probably damaging	0.97
R7450:Kmo	UTSW	1	175639100	missense	probably benign	0.01
R7545:Kmo	UTSW	1	175653628	missense	probably damaging	1.00
R7829:Kmo	UTSW	1	175650659	splice site	probably null
R7916:Kmo	UTSW	1	175659670	missense	probably damaging	1.00
R8169:Kmo	UTSW	1	175649163	missense	probably benign	0.10
R8515:Kmo	UTSW	1	175647152	missense	probably damaging	1.00
X0027:Kmo	UTSW	1	175647193	missense	probably benign	0.00
Z1177:Kmo	UTSW	1	175649186	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTCTTTCCTCCAGGGAAAAGTGAC -3'
(R):5'- AGACTTTGCTCTAACGCTGGCTTC -3'

Sequencing Primer
(F):5'- GACAAAGCTGAGTTGAAAATTCCC -3'
(R):5'- TCCCATCAGAGGGATAGCATCT -3'

Posted On

2014-01-05