Incidental Mutation 'R1034:Kmo'
ID95372
Institutional Source Beutler Lab
Gene Symbol Kmo
Ensembl Gene ENSMUSG00000039783
Gene Namekynurenine 3-monooxygenase (kynurenine 3-hydroxylase)
Synonyms
MMRRC Submission 039133-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1034 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location175620381-175662116 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 175651618 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 240 (P240L)
Ref Sequence ENSEMBL: ENSMUSP00000095067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040250] [ENSMUST00000097458] [ENSMUST00000140474]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040250
AA Change: P240L

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038914
Gene: ENSMUSG00000039783
AA Change: P240L

DomainStartEndE-ValueType
Pfam:FAD_binding_3 9 328 5.6e-22 PFAM
Pfam:NAD_binding_8 13 63 2.2e-7 PFAM
transmembrane domain 425 447 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000097458
AA Change: P240L

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095067
Gene: ENSMUSG00000039783
AA Change: P240L

DomainStartEndE-ValueType
Pfam:FAD_binding_3 9 328 5.8e-22 PFAM
Pfam:NAD_binding_8 13 63 2.1e-7 PFAM
transmembrane domain 391 413 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137174
Predicted Effect silent
Transcript: ENSMUST00000140474
SMART Domains Protein: ENSMUSP00000122943
Gene: ENSMUSG00000039783

DomainStartEndE-ValueType
Pfam:FAD_binding_3 44 240 2.9e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142223
Meta Mutation Damage Score 0.9221 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.3%
  • 10x: 92.9%
  • 20x: 82.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrion outer membrane protein that catalyzes the hydroxylation of L-tryptophan metabolite, L-kynurenine, to form L-3-hydroxykynurenine. Studies in yeast identified this gene as a therapeutic target for Huntington disease. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele lack kynurenine 3-monooxygenase activity and altered levels of several tryptophan metabolites. Mice homozygous for another null allele exhibit increased LPS-induced depressive behaviors and altered kynurenine metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Abca14 T C 7: 120,216,147 F206S probably damaging Het
Arid2 T C 15: 96,369,505 V622A probably benign Het
Asic1 T A 15: 99,698,058 L437Q probably damaging Het
Atp1b1 C T 1: 164,453,488 probably null Het
B3gnt5 A G 16: 19,769,484 Y151C probably damaging Het
Cbx4 A G 11: 119,081,707 S281P probably damaging Het
Dnah5 G A 15: 28,302,471 V1625I probably damaging Het
Eftud2 A C 11: 102,849,184 D461E probably benign Het
Epgn A G 5: 91,032,221 Y74C probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fgf14 C T 14: 124,132,534 V113I probably damaging Het
Ggcx G A 6: 72,414,831 R68H probably damaging Het
Gm1110 A G 9: 26,921,350 S16P probably damaging Het
Gm6729 T C 10: 86,540,026 noncoding transcript Het
Gpr108 A G 17: 57,235,995 F522S probably damaging Het
Gpr156 T C 16: 38,004,726 V435A probably benign Het
Khdrbs2 T C 1: 32,467,791 L172P probably damaging Het
Ltn1 A T 16: 87,397,137 probably null Het
Nbeal1 T A 1: 60,290,006 Y2194* probably null Het
Olfr767 T A 10: 129,079,961 M1L probably benign Het
Olfr867 A T 9: 20,055,365 S33T probably benign Het
Rab6b T C 9: 103,167,124 S172P probably benign Het
Ror1 T A 4: 100,333,620 L58* probably null Het
Sec23b A G 2: 144,590,338 D756G possibly damaging Het
Slc24a2 T A 4: 87,032,275 K428N probably damaging Het
Spen C A 4: 141,475,752 V1855L probably benign Het
Srgap1 G A 10: 121,785,445 P1071S possibly damaging Het
Tns1 A G 1: 73,941,969 C1079R probably damaging Het
Traf3ip1 G T 1: 91,518,319 probably null Het
Trmt2a T C 16: 18,249,709 F82S probably damaging Het
Xrn1 A G 9: 96,039,737 D1401G probably damaging Het
Zfp352 T A 4: 90,224,156 S178T possibly damaging Het
Zfp758 G T 17: 22,375,759 E409* probably null Het
Other mutations in Kmo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01400:Kmo APN 1 175655095 missense possibly damaging 0.54
IGL01734:Kmo APN 1 175655102 missense probably benign 0.00
IGL02415:Kmo APN 1 175649323 splice site probably benign
IGL02551:Kmo APN 1 175637919 missense probably damaging 1.00
IGL02866:Kmo APN 1 175653588 missense probably damaging 1.00
IGL03140:Kmo APN 1 175649220 missense probably damaging 1.00
R0613:Kmo UTSW 1 175637892 missense probably damaging 1.00
R0617:Kmo UTSW 1 175647190 missense possibly damaging 0.85
R0883:Kmo UTSW 1 175647140 missense possibly damaging 0.70
R1037:Kmo UTSW 1 175651618 missense possibly damaging 0.95
R1164:Kmo UTSW 1 175658559 missense probably benign 0.00
R1519:Kmo UTSW 1 175651618 missense possibly damaging 0.95
R1519:Kmo UTSW 1 175656802 missense probably damaging 1.00
R1712:Kmo UTSW 1 175656723 missense probably benign
R1796:Kmo UTSW 1 175637895 missense probably benign 0.00
R1938:Kmo UTSW 1 175651588 missense possibly damaging 0.88
R4531:Kmo UTSW 1 175659707 unclassified probably null
R4586:Kmo UTSW 1 175650572 missense probably damaging 1.00
R4586:Kmo UTSW 1 175650573 missense possibly damaging 0.90
R4603:Kmo UTSW 1 175651642 missense probably benign 0.13
R4647:Kmo UTSW 1 175659774 nonsense probably null
R4728:Kmo UTSW 1 175656763 missense possibly damaging 0.51
R5569:Kmo UTSW 1 175655122 missense probably benign 0.04
R5571:Kmo UTSW 1 175647194 missense possibly damaging 0.46
R6109:Kmo UTSW 1 175637908 missense possibly damaging 0.67
R6244:Kmo UTSW 1 175659695 missense possibly damaging 0.91
R6943:Kmo UTSW 1 175658375 missense probably benign 0.00
R7148:Kmo UTSW 1 175651602 missense probably damaging 1.00
R7319:Kmo UTSW 1 175653655 missense probably damaging 0.97
R7450:Kmo UTSW 1 175639100 missense probably benign 0.01
R7545:Kmo UTSW 1 175653628 missense probably damaging 1.00
R7829:Kmo UTSW 1 175650659 intron probably null
R8169:Kmo UTSW 1 175649163 missense probably benign 0.10
X0027:Kmo UTSW 1 175647193 missense probably benign 0.00
Z1177:Kmo UTSW 1 175649186 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCTTTCCTCCAGGGAAAAGTGAC -3'
(R):5'- AGACTTTGCTCTAACGCTGGCTTC -3'

Sequencing Primer
(F):5'- GACAAAGCTGAGTTGAAAATTCCC -3'
(R):5'- TCCCATCAGAGGGATAGCATCT -3'
Posted On2014-01-05