Incidental Mutation 'R1034:Slc24a2'
ID 95380
Institutional Source Beutler Lab
Gene Symbol Slc24a2
Ensembl Gene ENSMUSG00000037996
Gene Name solute carrier family 24 (sodium/potassium/calcium exchanger), member 2
Synonyms 6330417K15Rik
MMRRC Submission 039133-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock # R1034 (G1)
Quality Score 207
Status Not validated
Chromosome 4
Chromosomal Location 86983124-87230477 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 87032275 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 428 (K428N)
Ref Sequence ENSEMBL: ENSMUSP00000102776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044990] [ENSMUST00000107155] [ENSMUST00000107157] [ENSMUST00000107158]
AlphaFold Q14BI1
Predicted Effect probably benign
Transcript: ENSMUST00000044990
AA Change: K383N

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000043937
Gene: ENSMUSG00000037996
AA Change: K383N

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
Pfam:Na_Ca_ex 149 281 3.7e-34 PFAM
low complexity region 445 457 N/A INTRINSIC
transmembrane domain 472 489 N/A INTRINSIC
Pfam:Na_Ca_ex 509 648 8.9e-32 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107155
AA Change: K366N

PolyPhen 2 Score 0.884 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102773
Gene: ENSMUSG00000037996
AA Change: K366N

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
Pfam:Na_Ca_ex 149 281 3.6e-34 PFAM
low complexity region 428 440 N/A INTRINSIC
transmembrane domain 455 472 N/A INTRINSIC
Pfam:Na_Ca_ex 492 631 8.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107157
AA Change: K383N

PolyPhen 2 Score 0.338 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102775
Gene: ENSMUSG00000037996
AA Change: K383N

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
Pfam:Na_Ca_ex 139 283 7.2e-32 PFAM
transmembrane domain 476 493 N/A INTRINSIC
Pfam:Na_Ca_ex 503 654 4.4e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107158
AA Change: K428N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102776
Gene: ENSMUSG00000037996
AA Change: K428N

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
Pfam:Na_Ca_ex 139 283 8e-32 PFAM
transmembrane domain 521 538 N/A INTRINSIC
Pfam:Na_Ca_ex 548 699 4.9e-34 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000146815
AA Change: K113N
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.3%
  • 10x: 92.9%
  • 20x: 82.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium/cation antiporter superfamily of transport proteins. The encoded protein belongs to the SLC24 branch of exchangers, which can mediate the extrusion of one Ca2+ ion and one K+ ion in exchange for four Na+ ions. This family member is a retinal cone/brain exchanger that can mediate a light-induced decrease in free Ca2+ concentration. This protein may also play a neuroprotective role during ischemic brain injury. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous mutation of this gene results in loss of long term potentiation and an increase in long term depression and deficits in motor learning and spatial working memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Abca14 T C 7: 120,216,147 F206S probably damaging Het
Arid2 T C 15: 96,369,505 V622A probably benign Het
Asic1 T A 15: 99,698,058 L437Q probably damaging Het
Atp1b1 C T 1: 164,453,488 probably null Het
B3gnt5 A G 16: 19,769,484 Y151C probably damaging Het
Cbx4 A G 11: 119,081,707 S281P probably damaging Het
Dnah5 G A 15: 28,302,471 V1625I probably damaging Het
Eftud2 A C 11: 102,849,184 D461E probably benign Het
Epgn A G 5: 91,032,221 Y74C probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fgf14 C T 14: 124,132,534 V113I probably damaging Het
Ggcx G A 6: 72,414,831 R68H probably damaging Het
Gm1110 A G 9: 26,921,350 S16P probably damaging Het
Gm6729 T C 10: 86,540,026 noncoding transcript Het
Gpr108 A G 17: 57,235,995 F522S probably damaging Het
Gpr156 T C 16: 38,004,726 V435A probably benign Het
Khdrbs2 T C 1: 32,467,791 L172P probably damaging Het
Kmo C T 1: 175,651,618 P240L possibly damaging Het
Ltn1 A T 16: 87,397,137 probably null Het
Nbeal1 T A 1: 60,290,006 Y2194* probably null Het
Olfr767 T A 10: 129,079,961 M1L probably benign Het
Olfr867 A T 9: 20,055,365 S33T probably benign Het
Rab6b T C 9: 103,167,124 S172P probably benign Het
Ror1 T A 4: 100,333,620 L58* probably null Het
Sec23b A G 2: 144,590,338 D756G possibly damaging Het
Spen C A 4: 141,475,752 V1855L probably benign Het
Srgap1 G A 10: 121,785,445 P1071S possibly damaging Het
Tns1 A G 1: 73,941,969 C1079R probably damaging Het
Traf3ip1 G T 1: 91,518,319 probably null Het
Trmt2a T C 16: 18,249,709 F82S probably damaging Het
Xrn1 A G 9: 96,039,737 D1401G probably damaging Het
Zfp352 T A 4: 90,224,156 S178T possibly damaging Het
Zfp758 G T 17: 22,375,759 E409* probably null Het
Other mutations in Slc24a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01987:Slc24a2 APN 4 87227796 missense probably benign 0.01
IGL02080:Slc24a2 APN 4 87227146 missense probably damaging 1.00
IGL03121:Slc24a2 APN 4 87226906 missense probably benign 0.00
G1patch:Slc24a2 UTSW 4 87226882 critical splice donor site probably null
PIT4403001:Slc24a2 UTSW 4 87032286 missense probably benign 0.45
R0024:Slc24a2 UTSW 4 87028240 unclassified probably benign
R0024:Slc24a2 UTSW 4 87028240 unclassified probably benign
R0372:Slc24a2 UTSW 4 87227292 missense probably damaging 1.00
R1577:Slc24a2 UTSW 4 86991411 missense probably damaging 1.00
R1776:Slc24a2 UTSW 4 87176289 missense probably benign 0.01
R1955:Slc24a2 UTSW 4 87073244 missense probably damaging 1.00
R2043:Slc24a2 UTSW 4 86996645 missense probably damaging 1.00
R2091:Slc24a2 UTSW 4 87011646 missense probably damaging 1.00
R2114:Slc24a2 UTSW 4 86991355 missense probably benign 0.07
R2921:Slc24a2 UTSW 4 86991354 missense possibly damaging 0.46
R2922:Slc24a2 UTSW 4 86991354 missense possibly damaging 0.46
R2924:Slc24a2 UTSW 4 87011724 missense probably benign 0.34
R3806:Slc24a2 UTSW 4 87227784 missense possibly damaging 0.92
R3933:Slc24a2 UTSW 4 87176185 missense probably benign
R4052:Slc24a2 UTSW 4 87227205 missense probably damaging 1.00
R4207:Slc24a2 UTSW 4 87227205 missense probably damaging 1.00
R4466:Slc24a2 UTSW 4 87227862 utr 5 prime probably benign
R4531:Slc24a2 UTSW 4 86991478 missense possibly damaging 0.91
R4561:Slc24a2 UTSW 4 87227397 missense probably damaging 1.00
R4808:Slc24a2 UTSW 4 87032238 missense probably benign 0.01
R4884:Slc24a2 UTSW 4 86991508 missense probably damaging 0.98
R4893:Slc24a2 UTSW 4 87226908 missense probably damaging 0.98
R4936:Slc24a2 UTSW 4 87227347 missense probably damaging 1.00
R5035:Slc24a2 UTSW 4 87011706 missense possibly damaging 0.48
R5171:Slc24a2 UTSW 4 86996634 missense probably benign 0.40
R5369:Slc24a2 UTSW 4 86991388 missense probably damaging 0.99
R5924:Slc24a2 UTSW 4 87011588 splice site probably null
R6046:Slc24a2 UTSW 4 86996645 missense probably damaging 1.00
R6725:Slc24a2 UTSW 4 87226882 critical splice donor site probably null
R6756:Slc24a2 UTSW 4 87176292 missense probably benign
R7087:Slc24a2 UTSW 4 86991219 splice site probably null
R7804:Slc24a2 UTSW 4 86991537 missense probably damaging 1.00
R8003:Slc24a2 UTSW 4 87176315 missense probably benign 0.04
R8058:Slc24a2 UTSW 4 86991513 missense probably damaging 1.00
R8428:Slc24a2 UTSW 4 87227100 missense probably damaging 1.00
R8529:Slc24a2 UTSW 4 87028280 missense possibly damaging 0.51
R9656:Slc24a2 UTSW 4 87049907 missense probably damaging 1.00
X0003:Slc24a2 UTSW 4 86991447 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGGAAGGGCCTGAACTAGGACTG -3'
(R):5'- ACCGAACTGGGCTGAAGAATCCAC -3'

Sequencing Primer
(F):5'- CTGAACTAGGACTGGGGCAG -3'
(R):5'- CCAAGGTAAGAGAGCGCCC -3'
Posted On 2014-01-05