Mutagenetix > Incidental Mutation

Incidental Mutation 'R1034:Slc24a2'

95380

Institutional Source

Beutler Lab

Gene Symbol

Slc24a2

Ensembl Gene

ENSMUSG00000037996

Gene Name

solute carrier family 24 (sodium/potassium/calcium exchanger), member 2

Synonyms

6330417K15Rik

MMRRC Submission

039133-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.196) question?

Stock #

R1034 (G1)

Quality Score

207

Status

Not validated

Chromosome

Chromosomal Location

86983124-87230477 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 87032275 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 428 (K428N)

Ref Sequence

ENSEMBL: ENSMUSP00000102776 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044990] [ENSMUST00000107155] [ENSMUST00000107157] [ENSMUST00000107158]

AlphaFold

Q14BI1

Predicted Effect

probably benign
Transcript: ENSMUST00000044990
AA Change: K383N

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000043937
Gene: ENSMUSG00000037996
AA Change: K383N

Domain	Start	End	E-Value	Type
transmembrane domain	36	58	N/A	INTRINSIC
Pfam:Na_Ca_ex	149	281	3.7e-34	PFAM
low complexity region	445	457	N/A	INTRINSIC
transmembrane domain	472	489	N/A	INTRINSIC
Pfam:Na_Ca_ex	509	648	8.9e-32	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107155
AA Change: K366N

PolyPhen 2 Score 0.884 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000102773
Gene: ENSMUSG00000037996
AA Change: K366N

Domain	Start	End	E-Value	Type
transmembrane domain	36	58	N/A	INTRINSIC
Pfam:Na_Ca_ex	149	281	3.6e-34	PFAM
low complexity region	428	440	N/A	INTRINSIC
transmembrane domain	455	472	N/A	INTRINSIC
Pfam:Na_Ca_ex	492	631	8.5e-32	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000107157
AA Change: K383N

PolyPhen 2 Score 0.338 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000102775
Gene: ENSMUSG00000037996
AA Change: K383N

Domain	Start	End	E-Value	Type
transmembrane domain	36	58	N/A	INTRINSIC
Pfam:Na_Ca_ex	139	283	7.2e-32	PFAM
transmembrane domain	476	493	N/A	INTRINSIC
Pfam:Na_Ca_ex	503	654	4.4e-34	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000107158
AA Change: K428N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000102776
Gene: ENSMUSG00000037996
AA Change: K428N

Domain	Start	End	E-Value	Type
transmembrane domain	36	58	N/A	INTRINSIC
Pfam:Na_Ca_ex	139	283	8e-32	PFAM
transmembrane domain	521	538	N/A	INTRINSIC
Pfam:Na_Ca_ex	548	699	4.9e-34	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000146815
AA Change: K113N

Coding Region Coverage

1x: 98.7%
3x: 97.3%
10x: 92.9%
20x: 82.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium/cation antiporter superfamily of transport proteins. The encoded protein belongs to the SLC24 branch of exchangers, which can mediate the extrusion of one Ca2+ ion and one K+ ion in exchange for four Na+ ions. This family member is a retinal cone/brain exchanger that can mediate a light-induced decrease in free Ca2+ concentration. This protein may also play a neuroprotective role during ischemic brain injury. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous mutation of this gene results in loss of long term potentiation and an increase in long term depression and deficits in motor learning and spatial working memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	G	A	5: 76,876,283	T174M	probably damaging	Het
Abca14	T	C	7: 120,216,147	F206S	probably damaging	Het
Arid2	T	C	15: 96,369,505	V622A	probably benign	Het
Asic1	T	A	15: 99,698,058	L437Q	probably damaging	Het
Atp1b1	C	T	1: 164,453,488		probably null	Het
B3gnt5	A	G	16: 19,769,484	Y151C	probably damaging	Het
Cbx4	A	G	11: 119,081,707	S281P	probably damaging	Het
Dnah5	G	A	15: 28,302,471	V1625I	probably damaging	Het
Eftud2	A	C	11: 102,849,184	D461E	probably benign	Het
Epgn	A	G	5: 91,032,221	Y74C	probably damaging	Het
Fcho1	C	T	8: 71,712,560	A418T	probably benign	Het
Fgf14	C	T	14: 124,132,534	V113I	probably damaging	Het
Ggcx	G	A	6: 72,414,831	R68H	probably damaging	Het
Gm1110	A	G	9: 26,921,350	S16P	probably damaging	Het
Gm6729	T	C	10: 86,540,026		noncoding transcript	Het
Gpr108	A	G	17: 57,235,995	F522S	probably damaging	Het
Gpr156	T	C	16: 38,004,726	V435A	probably benign	Het
Khdrbs2	T	C	1: 32,467,791	L172P	probably damaging	Het
Kmo	C	T	1: 175,651,618	P240L	possibly damaging	Het
Ltn1	A	T	16: 87,397,137		probably null	Het
Nbeal1	T	A	1: 60,290,006	Y2194*	probably null	Het
Olfr767	T	A	10: 129,079,961	M1L	probably benign	Het
Olfr867	A	T	9: 20,055,365	S33T	probably benign	Het
Rab6b	T	C	9: 103,167,124	S172P	probably benign	Het
Ror1	T	A	4: 100,333,620	L58*	probably null	Het
Sec23b	A	G	2: 144,590,338	D756G	possibly damaging	Het
Spen	C	A	4: 141,475,752	V1855L	probably benign	Het
Srgap1	G	A	10: 121,785,445	P1071S	possibly damaging	Het
Tns1	A	G	1: 73,941,969	C1079R	probably damaging	Het
Traf3ip1	G	T	1: 91,518,319		probably null	Het
Trmt2a	T	C	16: 18,249,709	F82S	probably damaging	Het
Xrn1	A	G	9: 96,039,737	D1401G	probably damaging	Het
Zfp352	T	A	4: 90,224,156	S178T	possibly damaging	Het
Zfp758	G	T	17: 22,375,759	E409*	probably null	Het

Other mutations in Slc24a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01987:Slc24a2	APN	4	87227796	missense	probably benign	0.01
IGL02080:Slc24a2	APN	4	87227146	missense	probably damaging	1.00
IGL03121:Slc24a2	APN	4	87226906	missense	probably benign	0.00
G1patch:Slc24a2	UTSW	4	87226882	critical splice donor site	probably null
PIT4403001:Slc24a2	UTSW	4	87032286	missense	probably benign	0.45
R0024:Slc24a2	UTSW	4	87028240	unclassified	probably benign
R0024:Slc24a2	UTSW	4	87028240	unclassified	probably benign
R0372:Slc24a2	UTSW	4	87227292	missense	probably damaging	1.00
R1577:Slc24a2	UTSW	4	86991411	missense	probably damaging	1.00
R1776:Slc24a2	UTSW	4	87176289	missense	probably benign	0.01
R1955:Slc24a2	UTSW	4	87073244	missense	probably damaging	1.00
R2043:Slc24a2	UTSW	4	86996645	missense	probably damaging	1.00
R2091:Slc24a2	UTSW	4	87011646	missense	probably damaging	1.00
R2114:Slc24a2	UTSW	4	86991355	missense	probably benign	0.07
R2921:Slc24a2	UTSW	4	86991354	missense	possibly damaging	0.46
R2922:Slc24a2	UTSW	4	86991354	missense	possibly damaging	0.46
R2924:Slc24a2	UTSW	4	87011724	missense	probably benign	0.34
R3806:Slc24a2	UTSW	4	87227784	missense	possibly damaging	0.92
R3933:Slc24a2	UTSW	4	87176185	missense	probably benign
R4052:Slc24a2	UTSW	4	87227205	missense	probably damaging	1.00
R4207:Slc24a2	UTSW	4	87227205	missense	probably damaging	1.00
R4466:Slc24a2	UTSW	4	87227862	utr 5 prime	probably benign
R4531:Slc24a2	UTSW	4	86991478	missense	possibly damaging	0.91
R4561:Slc24a2	UTSW	4	87227397	missense	probably damaging	1.00
R4808:Slc24a2	UTSW	4	87032238	missense	probably benign	0.01
R4884:Slc24a2	UTSW	4	86991508	missense	probably damaging	0.98
R4893:Slc24a2	UTSW	4	87226908	missense	probably damaging	0.98
R4936:Slc24a2	UTSW	4	87227347	missense	probably damaging	1.00
R5035:Slc24a2	UTSW	4	87011706	missense	possibly damaging	0.48
R5171:Slc24a2	UTSW	4	86996634	missense	probably benign	0.40
R5369:Slc24a2	UTSW	4	86991388	missense	probably damaging	0.99
R5924:Slc24a2	UTSW	4	87011588	splice site	probably null
R6046:Slc24a2	UTSW	4	86996645	missense	probably damaging	1.00
R6725:Slc24a2	UTSW	4	87226882	critical splice donor site	probably null
R6756:Slc24a2	UTSW	4	87176292	missense	probably benign
R7087:Slc24a2	UTSW	4	86991219	splice site	probably null
R7804:Slc24a2	UTSW	4	86991537	missense	probably damaging	1.00
R8003:Slc24a2	UTSW	4	87176315	missense	probably benign	0.04
R8058:Slc24a2	UTSW	4	86991513	missense	probably damaging	1.00
R8428:Slc24a2	UTSW	4	87227100	missense	probably damaging	1.00
R8529:Slc24a2	UTSW	4	87028280	missense	possibly damaging	0.51
R9656:Slc24a2	UTSW	4	87049907	missense	probably damaging	1.00
X0003:Slc24a2	UTSW	4	86991447	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTAGGAAGGGCCTGAACTAGGACTG -3'
(R):5'- ACCGAACTGGGCTGAAGAATCCAC -3'

Sequencing Primer
(F):5'- CTGAACTAGGACTGGGGCAG -3'
(R):5'- CCAAGGTAAGAGAGCGCCC -3'

Posted On

2014-01-05