Incidental Mutation 'R1139:Alox12b'
ID95398
Institutional Source Beutler Lab
Gene Symbol Alox12b
Ensembl Gene ENSMUSG00000032807
Gene Namearachidonate 12-lipoxygenase, 12R type
Synonymse-LOX2, 12R-LOX, Aloxe2
MMRRC Submission 039212-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1139 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location69156989-69169792 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69164405 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 334 (Q334L)
Ref Sequence ENSEMBL: ENSMUSP00000035250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036424]
Predicted Effect probably damaging
Transcript: ENSMUST00000036424
AA Change: Q334L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035250
Gene: ENSMUSG00000032807
AA Change: Q334L

DomainStartEndE-ValueType
LH2 2 116 9.9e-32 SMART
low complexity region 164 175 N/A INTRINSIC
Pfam:Lipoxygenase 228 686 5.3e-59 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an enzyme involved in the conversion of arachidonic acid to 12R-hydroxyeicosatetraenoic acid. Mutations in this gene can prevent the formation of the epidermal permeability barrier and cause an ichthyosiform phenotype. [provided by RefSeq, Sep 2015]
PHENOTYPE: Neonatal homozygous mutant mice exhibit reddened skin that quickly dehydrates and appears scaly. The epidermis is hyperkeratotic, and its permeability barrier function is compromised. Homozygotes die within 24 hours of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G A 11: 58,288,286 V149M probably damaging Het
4931408C20Rik T G 1: 26,682,665 I1145L probably benign Het
Abcc4 A G 14: 118,500,840 M1166T possibly damaging Het
Adgra3 A T 5: 49,961,755 probably null Het
Bod1l A T 5: 41,831,471 M431K possibly damaging Het
Ckap5 A G 2: 91,581,143 N966D probably benign Het
Csmd3 C G 15: 47,695,836 D2240H probably damaging Het
Erbin A G 13: 103,884,253 F66S probably damaging Het
Mrgprh A T 17: 12,876,942 N23I probably benign Het
Mst1r G T 9: 107,919,969 D1346Y possibly damaging Het
Nfe2l2 A G 2: 75,676,886 M290T probably benign Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Olfr659 A G 7: 104,670,891 Y63C probably damaging Het
Olfr681 A G 7: 105,121,973 Y172C probably damaging Het
Olfr827 T C 10: 130,211,079 H17R possibly damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Rpgrip1 A C 14: 52,147,221 E757D probably benign Het
Scn9a T G 2: 66,504,997 K1207T probably benign Het
Ssb A G 2: 69,866,576 T87A possibly damaging Het
Tfdp1 C T 8: 13,373,000 R302C probably benign Het
Thbs4 T C 13: 92,774,718 Y319C probably damaging Het
Tiam2 C A 17: 3,477,267 Q67K possibly damaging Het
Tox3 A G 8: 90,248,869 L378P probably damaging Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Vcpip1 A T 1: 9,746,723 H478Q probably damaging Het
Vmn2r124 T C 17: 18,073,790 I713T possibly damaging Het
Other mutations in Alox12b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Alox12b APN 11 69166243 missense probably damaging 1.00
IGL02990:Alox12b APN 11 69163206 missense probably benign 0.17
IGL03106:Alox12b APN 11 69168876 nonsense probably null
R0126:Alox12b UTSW 11 69167471 missense probably benign 0.36
R0135:Alox12b UTSW 11 69162748 missense probably benign 0.06
R0305:Alox12b UTSW 11 69167379 missense probably benign 0.25
R0432:Alox12b UTSW 11 69169556 missense probably damaging 1.00
R0828:Alox12b UTSW 11 69166306 missense possibly damaging 0.89
R0854:Alox12b UTSW 11 69164476 critical splice donor site probably null
R1558:Alox12b UTSW 11 69165885 missense probably damaging 1.00
R1870:Alox12b UTSW 11 69158373 missense possibly damaging 0.94
R4088:Alox12b UTSW 11 69158385 missense probably benign 0.14
R4195:Alox12b UTSW 11 69169600 missense probably benign 0.02
R4248:Alox12b UTSW 11 69163605 missense probably benign
R4371:Alox12b UTSW 11 69169616 missense possibly damaging 0.86
R4774:Alox12b UTSW 11 69163207 missense probably benign 0.00
R5108:Alox12b UTSW 11 69157382 missense probably benign 0.11
R5252:Alox12b UTSW 11 69165936 missense probably damaging 1.00
R5579:Alox12b UTSW 11 69162932 missense probably benign 0.04
R6000:Alox12b UTSW 11 69169568 missense probably damaging 0.98
R6168:Alox12b UTSW 11 69169634 missense probably damaging 1.00
R6322:Alox12b UTSW 11 69158373 missense possibly damaging 0.94
R6634:Alox12b UTSW 11 69168821 nonsense probably null
R7026:Alox12b UTSW 11 69157305 missense possibly damaging 0.66
R7519:Alox12b UTSW 11 69163213 missense probably benign 0.37
R7669:Alox12b UTSW 11 69169341 missense probably benign 0.07
X0018:Alox12b UTSW 11 69157299 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTATTGCCCCTCCATCAACAAGG -3'
(R):5'- AGGTTGCACACAGGATGTTACACAC -3'

Sequencing Primer
(F):5'- CAACAAGGTCCATTTGAGTCTC -3'
(R):5'- TGATATGGACATACACTTGCCC -3'
Posted On2014-01-05