Incidental Mutation 'R1034:Epgn'
ID 95401
Institutional Source Beutler Lab
Gene Symbol Epgn
Ensembl Gene ENSMUSG00000035020
Gene Name epithelial mitogen
Synonyms 2310069M11Rik, epigen
MMRRC Submission 039133-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1034 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 91027464-91035215 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 91032221 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 74 (Y74C)
Ref Sequence ENSEMBL: ENSMUSP00000144500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041516] [ENSMUST00000202724]
AlphaFold Q924X1
Predicted Effect probably damaging
Transcript: ENSMUST00000041516
AA Change: Y89C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046987
Gene: ENSMUSG00000035020
AA Change: Y89C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EGF 58 95 1.01e-1 SMART
transmembrane domain 110 132 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202724
AA Change: Y74C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144500
Gene: ENSMUSG00000035020
AA Change: Y74C

DomainStartEndE-ValueType
EGF 43 80 5.1e-4 SMART
transmembrane domain 95 117 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.3%
  • 10x: 92.9%
  • 20x: 82.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the epidermal growth factor family. Members of this family are ligands for the epidermal growth factor receptor and play a role in cell survival, proliferation and migration. This protein has been reported to have high mitogenic activity but low affinity for its receptor. Expression of this transcript and protein have been reported in cancer specimens of the breast, bladder, and prostate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit moderate increase in absolute pancreas and spleen weight but normal epidermis and pilosebaceous unit development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Abca14 T C 7: 120,216,147 F206S probably damaging Het
Arid2 T C 15: 96,369,505 V622A probably benign Het
Asic1 T A 15: 99,698,058 L437Q probably damaging Het
Atp1b1 C T 1: 164,453,488 probably null Het
B3gnt5 A G 16: 19,769,484 Y151C probably damaging Het
Cbx4 A G 11: 119,081,707 S281P probably damaging Het
Dnah5 G A 15: 28,302,471 V1625I probably damaging Het
Eftud2 A C 11: 102,849,184 D461E probably benign Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fgf14 C T 14: 124,132,534 V113I probably damaging Het
Ggcx G A 6: 72,414,831 R68H probably damaging Het
Gm1110 A G 9: 26,921,350 S16P probably damaging Het
Gm6729 T C 10: 86,540,026 noncoding transcript Het
Gpr108 A G 17: 57,235,995 F522S probably damaging Het
Gpr156 T C 16: 38,004,726 V435A probably benign Het
Khdrbs2 T C 1: 32,467,791 L172P probably damaging Het
Kmo C T 1: 175,651,618 P240L possibly damaging Het
Ltn1 A T 16: 87,397,137 probably null Het
Nbeal1 T A 1: 60,290,006 Y2194* probably null Het
Olfr767 T A 10: 129,079,961 M1L probably benign Het
Olfr867 A T 9: 20,055,365 S33T probably benign Het
Rab6b T C 9: 103,167,124 S172P probably benign Het
Ror1 T A 4: 100,333,620 L58* probably null Het
Sec23b A G 2: 144,590,338 D756G possibly damaging Het
Slc24a2 T A 4: 87,032,275 K428N probably damaging Het
Spen C A 4: 141,475,752 V1855L probably benign Het
Srgap1 G A 10: 121,785,445 P1071S possibly damaging Het
Tns1 A G 1: 73,941,969 C1079R probably damaging Het
Traf3ip1 G T 1: 91,518,319 probably null Het
Trmt2a T C 16: 18,249,709 F82S probably damaging Het
Xrn1 A G 9: 96,039,737 D1401G probably damaging Het
Zfp352 T A 4: 90,224,156 S178T possibly damaging Het
Zfp758 G T 17: 22,375,759 E409* probably null Het
Other mutations in Epgn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02090:Epgn APN 5 91033957 missense probably damaging 0.99
R0309:Epgn UTSW 5 91032214 missense probably benign 0.06
R0478:Epgn UTSW 5 91031128 missense probably benign 0.00
R4551:Epgn UTSW 5 91027562 nonsense probably null
R4552:Epgn UTSW 5 91027562 nonsense probably null
R4553:Epgn UTSW 5 91027562 nonsense probably null
R4997:Epgn UTSW 5 91032239 missense possibly damaging 0.58
R5177:Epgn UTSW 5 91028277 start gained probably benign
R5754:Epgn UTSW 5 91033948 missense probably benign 0.09
R5881:Epgn UTSW 5 91028363 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GTGCTAAAGTGCAGGCTGTCTCAT -3'
(R):5'- TCCCACTTTTAACTTTGACTCAGGCAA -3'

Sequencing Primer
(F):5'- TTCATGGACTGGCTTCCTTG -3'
(R):5'- ctcccctcccctccctc -3'
Posted On 2014-01-05