Incidental Mutation 'R1034:Ggcx'
ID 95407
Institutional Source Beutler Lab
Gene Symbol Ggcx
Ensembl Gene ENSMUSG00000053460
Gene Name gamma-glutamyl carboxylase
Synonyms vitamin K-dependent carboxylase
MMRRC Submission 039133-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.892) question?
Stock # R1034 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 72391291-72407695 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 72391814 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 68 (R68H)
Ref Sequence ENSEMBL: ENSMUSP00000146112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065906] [ENSMUST00000205738]
AlphaFold Q9QYC7
Predicted Effect probably damaging
Transcript: ENSMUST00000065906
AA Change: R68H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070109
Gene: ENSMUSG00000053460
AA Change: R68H

DomainStartEndE-ValueType
HTTM 56 315 1.34e-131 SMART
low complexity region 368 377 N/A INTRINSIC
low complexity region 630 645 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132995
Predicted Effect probably damaging
Transcript: ENSMUST00000205738
AA Change: R68H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000207012
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.3%
  • 10x: 92.9%
  • 20x: 82.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein of the rough endoplasmic reticulum that carboxylates glutamate residues of vitamin K-dependent proteins to gamma carboxyl glutamate, a modification that is required for their activity. The vitamin K-dependent protein substrates have a propeptide that binds the enzyme, with carbon dioxide, dioxide, and reduced vitamin K acting as co-substrates. Vitamin K-dependent proteins affect a number of physiologic processes including blood coagulation, prevention of vascular calcification, and inflammation. Allelic variants of this gene have been associated with pseudoxanthoma elasticum-like disorder with associated multiple coagulation factor deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Approximately 50% of embryos homozygous for a knock-out allele die between E9.5 and E18 while those surviving to term die of massive intra-abdominal hemorrhage shortly after birth with no evidence of ectopic calcification. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 77,024,130 (GRCm39) T174M probably damaging Het
Abca14 T C 7: 119,815,370 (GRCm39) F206S probably damaging Het
Arid2 T C 15: 96,267,386 (GRCm39) V622A probably benign Het
Asic1 T A 15: 99,595,939 (GRCm39) L437Q probably damaging Het
Atp1b1 C T 1: 164,281,057 (GRCm39) probably null Het
B3gnt5 A G 16: 19,588,234 (GRCm39) Y151C probably damaging Het
Cbx4 A G 11: 118,972,533 (GRCm39) S281P probably damaging Het
Dnah5 G A 15: 28,302,617 (GRCm39) V1625I probably damaging Het
Eftud2 A C 11: 102,740,010 (GRCm39) D461E probably benign Het
Epgn A G 5: 91,180,080 (GRCm39) Y74C probably damaging Het
Fcho1 C T 8: 72,165,204 (GRCm39) A418T probably benign Het
Fgf14 C T 14: 124,369,946 (GRCm39) V113I probably damaging Het
Gm1110 A G 9: 26,832,646 (GRCm39) S16P probably damaging Het
Gm6729 T C 10: 86,375,890 (GRCm39) noncoding transcript Het
Gpr108 A G 17: 57,542,995 (GRCm39) F522S probably damaging Het
Gpr156 T C 16: 37,825,088 (GRCm39) V435A probably benign Het
Khdrbs2 T C 1: 32,506,872 (GRCm39) L172P probably damaging Het
Kmo C T 1: 175,479,184 (GRCm39) P240L possibly damaging Het
Ltn1 A T 16: 87,194,025 (GRCm39) probably null Het
Nbeal1 T A 1: 60,329,165 (GRCm39) Y2194* probably null Het
Or6c8 T A 10: 128,915,830 (GRCm39) M1L probably benign Het
Or7d11 A T 9: 19,966,661 (GRCm39) S33T probably benign Het
Rab6b T C 9: 103,044,323 (GRCm39) S172P probably benign Het
Ror1 T A 4: 100,190,817 (GRCm39) L58* probably null Het
Sec23b A G 2: 144,432,258 (GRCm39) D756G possibly damaging Het
Slc24a2 T A 4: 86,950,512 (GRCm39) K428N probably damaging Het
Spen C A 4: 141,203,063 (GRCm39) V1855L probably benign Het
Srgap1 G A 10: 121,621,350 (GRCm39) P1071S possibly damaging Het
Tns1 A G 1: 73,981,128 (GRCm39) C1079R probably damaging Het
Traf3ip1 G T 1: 91,446,041 (GRCm39) probably null Het
Trmt2a T C 16: 18,067,573 (GRCm39) F82S probably damaging Het
Xrn1 A G 9: 95,921,790 (GRCm39) D1401G probably damaging Het
Zfp352 T A 4: 90,112,393 (GRCm39) S178T possibly damaging Het
Zfp758 G T 17: 22,594,740 (GRCm39) E409* probably null Het
Other mutations in Ggcx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01657:Ggcx APN 6 72,406,941 (GRCm39) splice site probably null
IGL02373:Ggcx APN 6 72,404,902 (GRCm39) missense probably damaging 1.00
IGL02589:Ggcx APN 6 72,406,131 (GRCm39) missense probably damaging 1.00
IGL02634:Ggcx APN 6 72,395,286 (GRCm39) missense probably damaging 1.00
IGL02661:Ggcx APN 6 72,395,343 (GRCm39) missense possibly damaging 0.78
IGL02701:Ggcx APN 6 72,395,455 (GRCm39) intron probably benign
R0503:Ggcx UTSW 6 72,406,140 (GRCm39) frame shift probably null
R2219:Ggcx UTSW 6 72,404,965 (GRCm39) missense probably benign 0.29
R3892:Ggcx UTSW 6 72,395,355 (GRCm39) missense probably damaging 0.99
R3951:Ggcx UTSW 6 72,403,541 (GRCm39) missense probably benign 0.01
R3952:Ggcx UTSW 6 72,403,541 (GRCm39) missense probably benign 0.01
R4320:Ggcx UTSW 6 72,405,803 (GRCm39) missense probably benign 0.24
R4321:Ggcx UTSW 6 72,405,803 (GRCm39) missense probably benign 0.24
R4322:Ggcx UTSW 6 72,405,803 (GRCm39) missense probably benign 0.24
R4324:Ggcx UTSW 6 72,405,803 (GRCm39) missense probably benign 0.24
R4782:Ggcx UTSW 6 72,405,875 (GRCm39) missense probably benign 0.01
R5370:Ggcx UTSW 6 72,402,914 (GRCm39) missense possibly damaging 0.69
R5523:Ggcx UTSW 6 72,401,017 (GRCm39) missense probably damaging 1.00
R5902:Ggcx UTSW 6 72,406,979 (GRCm39) missense possibly damaging 0.92
R6126:Ggcx UTSW 6 72,394,966 (GRCm39) missense possibly damaging 0.57
R6199:Ggcx UTSW 6 72,407,122 (GRCm39) missense possibly damaging 0.57
R6223:Ggcx UTSW 6 72,406,588 (GRCm39) missense probably damaging 0.97
R6515:Ggcx UTSW 6 72,402,815 (GRCm39) missense probably benign 0.33
R7205:Ggcx UTSW 6 72,404,987 (GRCm39) missense probably damaging 1.00
R7923:Ggcx UTSW 6 72,404,900 (GRCm39) missense probably damaging 1.00
R8034:Ggcx UTSW 6 72,405,587 (GRCm39) missense possibly damaging 0.47
R8096:Ggcx UTSW 6 72,406,976 (GRCm39) missense probably benign 0.33
R8116:Ggcx UTSW 6 72,406,511 (GRCm39) missense possibly damaging 0.66
R8356:Ggcx UTSW 6 72,406,574 (GRCm39) missense probably benign 0.03
R8977:Ggcx UTSW 6 72,406,265 (GRCm39) critical splice donor site probably null
R9074:Ggcx UTSW 6 72,402,924 (GRCm39) missense probably damaging 1.00
R9145:Ggcx UTSW 6 72,402,905 (GRCm39) missense probably benign 0.18
R9285:Ggcx UTSW 6 72,395,402 (GRCm39) nonsense probably null
R9362:Ggcx UTSW 6 72,405,015 (GRCm39) missense probably damaging 1.00
R9497:Ggcx UTSW 6 72,406,190 (GRCm39) missense probably damaging 1.00
Z1177:Ggcx UTSW 6 72,403,502 (GRCm39) missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TGCAGGAGCTGGATCAGTGGAA -3'
(R):5'- TGGGCAACTAggctggagagaa -3'

Sequencing Primer
(F):5'- AGGTCCTAGACTGTAGGGACTG -3'
(R):5'- caaaccacgaggagccag -3'
Posted On 2014-01-05