Incidental Mutation 'R1034:Fcho1'
ID 95422
Institutional Source Beutler Lab
Gene Symbol Fcho1
Ensembl Gene ENSMUSG00000070000
Gene Name FCH domain only 1
Synonyms 3322402E17Rik
MMRRC Submission 039133-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.259) question?
Stock # R1034 (G1)
Quality Score 180
Status Not validated
Chromosome 8
Chromosomal Location 72161031-72178360 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 72165204 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 418 (A418T)
Ref Sequence ENSEMBL: ENSMUSP00000117606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093444] [ENSMUST00000125092] [ENSMUST00000136640] [ENSMUST00000146100] [ENSMUST00000153800]
AlphaFold Q8K285
Predicted Effect probably benign
Transcript: ENSMUST00000093444
AA Change: A418T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000091151
Gene: ENSMUSG00000070000
AA Change: A418T

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
low complexity region 334 351 N/A INTRINSIC
low complexity region 364 382 N/A INTRINSIC
low complexity region 446 466 N/A INTRINSIC
low complexity region 567 576 N/A INTRINSIC
Pfam:muHD 610 872 4.9e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123425
SMART Domains Protein: ENSMUSP00000123631
Gene: ENSMUSG00000070000

DomainStartEndE-ValueType
low complexity region 52 70 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125092
SMART Domains Protein: ENSMUSP00000123554
Gene: ENSMUSG00000070000

DomainStartEndE-ValueType
FCH 6 88 7.62e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126455
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127005
Predicted Effect probably benign
Transcript: ENSMUST00000136640
SMART Domains Protein: ENSMUSP00000119273
Gene: ENSMUSG00000070000

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146100
AA Change: A418T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000117606
Gene: ENSMUSG00000070000
AA Change: A418T

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
low complexity region 334 351 N/A INTRINSIC
low complexity region 364 382 N/A INTRINSIC
low complexity region 446 466 N/A INTRINSIC
low complexity region 567 576 N/A INTRINSIC
Pfam:muHD 610 872 1.4e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149363
Predicted Effect probably benign
Transcript: ENSMUST00000153800
SMART Domains Protein: ENSMUSP00000116135
Gene: ENSMUSG00000070000

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
Meta Mutation Damage Score 0.0765 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.3%
  • 10x: 92.9%
  • 20x: 82.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 77,024,130 (GRCm39) T174M probably damaging Het
Abca14 T C 7: 119,815,370 (GRCm39) F206S probably damaging Het
Arid2 T C 15: 96,267,386 (GRCm39) V622A probably benign Het
Asic1 T A 15: 99,595,939 (GRCm39) L437Q probably damaging Het
Atp1b1 C T 1: 164,281,057 (GRCm39) probably null Het
B3gnt5 A G 16: 19,588,234 (GRCm39) Y151C probably damaging Het
Cbx4 A G 11: 118,972,533 (GRCm39) S281P probably damaging Het
Dnah5 G A 15: 28,302,617 (GRCm39) V1625I probably damaging Het
Eftud2 A C 11: 102,740,010 (GRCm39) D461E probably benign Het
Epgn A G 5: 91,180,080 (GRCm39) Y74C probably damaging Het
Fgf14 C T 14: 124,369,946 (GRCm39) V113I probably damaging Het
Ggcx G A 6: 72,391,814 (GRCm39) R68H probably damaging Het
Gm1110 A G 9: 26,832,646 (GRCm39) S16P probably damaging Het
Gm6729 T C 10: 86,375,890 (GRCm39) noncoding transcript Het
Gpr108 A G 17: 57,542,995 (GRCm39) F522S probably damaging Het
Gpr156 T C 16: 37,825,088 (GRCm39) V435A probably benign Het
Khdrbs2 T C 1: 32,506,872 (GRCm39) L172P probably damaging Het
Kmo C T 1: 175,479,184 (GRCm39) P240L possibly damaging Het
Ltn1 A T 16: 87,194,025 (GRCm39) probably null Het
Nbeal1 T A 1: 60,329,165 (GRCm39) Y2194* probably null Het
Or6c8 T A 10: 128,915,830 (GRCm39) M1L probably benign Het
Or7d11 A T 9: 19,966,661 (GRCm39) S33T probably benign Het
Rab6b T C 9: 103,044,323 (GRCm39) S172P probably benign Het
Ror1 T A 4: 100,190,817 (GRCm39) L58* probably null Het
Sec23b A G 2: 144,432,258 (GRCm39) D756G possibly damaging Het
Slc24a2 T A 4: 86,950,512 (GRCm39) K428N probably damaging Het
Spen C A 4: 141,203,063 (GRCm39) V1855L probably benign Het
Srgap1 G A 10: 121,621,350 (GRCm39) P1071S possibly damaging Het
Tns1 A G 1: 73,981,128 (GRCm39) C1079R probably damaging Het
Traf3ip1 G T 1: 91,446,041 (GRCm39) probably null Het
Trmt2a T C 16: 18,067,573 (GRCm39) F82S probably damaging Het
Xrn1 A G 9: 95,921,790 (GRCm39) D1401G probably damaging Het
Zfp352 T A 4: 90,112,393 (GRCm39) S178T possibly damaging Het
Zfp758 G T 17: 22,594,740 (GRCm39) E409* probably null Het
Other mutations in Fcho1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Fcho1 APN 8 72,166,167 (GRCm39) nonsense probably null
IGL01291:Fcho1 APN 8 72,165,191 (GRCm39) missense probably benign 0.08
IGL01473:Fcho1 APN 8 72,164,782 (GRCm39) missense probably benign 0.03
IGL02021:Fcho1 APN 8 72,173,919 (GRCm39) missense probably benign 0.06
IGL02086:Fcho1 APN 8 72,169,444 (GRCm39) missense probably damaging 1.00
IGL02808:Fcho1 APN 8 72,165,185 (GRCm39) missense possibly damaging 0.89
IGL03146:Fcho1 APN 8 72,170,074 (GRCm39) splice site probably benign
IGL03267:Fcho1 APN 8 72,164,943 (GRCm39) unclassified probably benign
cameo UTSW 8 72,169,507 (GRCm39) missense possibly damaging 0.92
Lesser UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
Sidekick UTSW 8 72,168,369 (GRCm39) missense probably damaging 1.00
ANU05:Fcho1 UTSW 8 72,165,191 (GRCm39) missense probably benign 0.08
R0003:Fcho1 UTSW 8 72,161,597 (GRCm39) missense probably damaging 1.00
R0010:Fcho1 UTSW 8 72,162,643 (GRCm39) missense probably damaging 1.00
R0020:Fcho1 UTSW 8 72,169,514 (GRCm39) missense probably benign 0.11
R0363:Fcho1 UTSW 8 72,170,134 (GRCm39) missense probably damaging 1.00
R0457:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R0485:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R0501:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R0502:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R0551:Fcho1 UTSW 8 72,164,818 (GRCm39) missense probably benign 0.06
R0583:Fcho1 UTSW 8 72,168,369 (GRCm39) missense probably damaging 1.00
R0584:Fcho1 UTSW 8 72,168,369 (GRCm39) missense probably damaging 1.00
R0585:Fcho1 UTSW 8 72,168,369 (GRCm39) missense probably damaging 1.00
R0612:Fcho1 UTSW 8 72,168,168 (GRCm39) missense probably damaging 1.00
R0614:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R0647:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R0841:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R0842:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R1036:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R1399:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R1466:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R1466:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R1618:Fcho1 UTSW 8 72,163,047 (GRCm39) missense probably damaging 0.98
R1754:Fcho1 UTSW 8 72,163,890 (GRCm39) missense probably benign
R1793:Fcho1 UTSW 8 72,161,666 (GRCm39) nonsense probably null
R2073:Fcho1 UTSW 8 72,163,133 (GRCm39) missense probably damaging 0.98
R2177:Fcho1 UTSW 8 72,164,905 (GRCm39) missense probably damaging 1.00
R4072:Fcho1 UTSW 8 72,163,013 (GRCm39) missense probably damaging 0.99
R4074:Fcho1 UTSW 8 72,163,013 (GRCm39) missense probably damaging 0.99
R4076:Fcho1 UTSW 8 72,163,013 (GRCm39) missense probably damaging 0.99
R4606:Fcho1 UTSW 8 72,165,124 (GRCm39) missense probably benign
R4732:Fcho1 UTSW 8 72,169,439 (GRCm39) missense probably benign 0.00
R4733:Fcho1 UTSW 8 72,169,439 (GRCm39) missense probably benign 0.00
R4860:Fcho1 UTSW 8 72,163,125 (GRCm39) missense probably benign 0.04
R4860:Fcho1 UTSW 8 72,163,125 (GRCm39) missense probably benign 0.04
R5082:Fcho1 UTSW 8 72,169,829 (GRCm39) missense possibly damaging 0.69
R5083:Fcho1 UTSW 8 72,169,820 (GRCm39) missense probably benign 0.00
R5185:Fcho1 UTSW 8 72,167,600 (GRCm39) unclassified probably benign
R6025:Fcho1 UTSW 8 72,165,217 (GRCm39) splice site probably null
R6624:Fcho1 UTSW 8 72,162,015 (GRCm39) missense probably damaging 0.99
R6875:Fcho1 UTSW 8 72,167,069 (GRCm39) splice site probably null
R7069:Fcho1 UTSW 8 72,163,141 (GRCm39) splice site probably null
R7476:Fcho1 UTSW 8 72,166,190 (GRCm39) missense probably damaging 1.00
R7512:Fcho1 UTSW 8 72,169,507 (GRCm39) missense possibly damaging 0.92
R7951:Fcho1 UTSW 8 72,164,920 (GRCm39) missense probably benign 0.00
R8699:Fcho1 UTSW 8 72,162,277 (GRCm39) missense possibly damaging 0.63
R8938:Fcho1 UTSW 8 72,169,790 (GRCm39) missense possibly damaging 0.96
R9090:Fcho1 UTSW 8 72,163,068 (GRCm39) missense possibly damaging 0.80
R9117:Fcho1 UTSW 8 72,164,712 (GRCm39) missense possibly damaging 0.87
R9119:Fcho1 UTSW 8 72,164,712 (GRCm39) missense possibly damaging 0.87
R9271:Fcho1 UTSW 8 72,163,068 (GRCm39) missense possibly damaging 0.80
R9433:Fcho1 UTSW 8 72,169,468 (GRCm39) missense probably benign 0.03
R9447:Fcho1 UTSW 8 72,169,913 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTAGTCCATGCCTAGTTGTCACC -3'
(R):5'- CAAAATTCTGGATGCGCGGATGAG -3'

Sequencing Primer
(F):5'- AGTTGTCACCGCCAATGTC -3'
(R):5'- CGCGGATGAGTGGGATG -3'
Posted On 2014-01-05