Incidental Mutation 'R1034:Olfr867'
ID 95424
Institutional Source Beutler Lab
Gene Symbol Olfr867
Ensembl Gene ENSMUSG00000044454
Gene Name olfactory receptor 867
Synonyms MOR143-2, GA_x6K02T2PVTD-13795933-13794938
MMRRC Submission 039133-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock # R1034 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 20050955-20057562 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 20055365 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 33 (S33T)
Ref Sequence ENSEMBL: ENSMUSP00000150378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060780] [ENSMUST00000212098] [ENSMUST00000216538]
AlphaFold Q7TRF3
Predicted Effect probably benign
Transcript: ENSMUST00000060780
AA Change: S33T

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000057469
Gene: ENSMUSG00000044454
AA Change: S33T

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.2e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 301 1.6e-6 PFAM
Pfam:7tm_1 41 290 1.1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212098
Predicted Effect probably benign
Transcript: ENSMUST00000216538
AA Change: S33T

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.3%
  • 10x: 92.9%
  • 20x: 82.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Abca14 T C 7: 120,216,147 F206S probably damaging Het
Arid2 T C 15: 96,369,505 V622A probably benign Het
Asic1 T A 15: 99,698,058 L437Q probably damaging Het
Atp1b1 C T 1: 164,453,488 probably null Het
B3gnt5 A G 16: 19,769,484 Y151C probably damaging Het
Cbx4 A G 11: 119,081,707 S281P probably damaging Het
Dnah5 G A 15: 28,302,471 V1625I probably damaging Het
Eftud2 A C 11: 102,849,184 D461E probably benign Het
Epgn A G 5: 91,032,221 Y74C probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fgf14 C T 14: 124,132,534 V113I probably damaging Het
Ggcx G A 6: 72,414,831 R68H probably damaging Het
Gm1110 A G 9: 26,921,350 S16P probably damaging Het
Gm6729 T C 10: 86,540,026 noncoding transcript Het
Gpr108 A G 17: 57,235,995 F522S probably damaging Het
Gpr156 T C 16: 38,004,726 V435A probably benign Het
Khdrbs2 T C 1: 32,467,791 L172P probably damaging Het
Kmo C T 1: 175,651,618 P240L possibly damaging Het
Ltn1 A T 16: 87,397,137 probably null Het
Nbeal1 T A 1: 60,290,006 Y2194* probably null Het
Olfr767 T A 10: 129,079,961 M1L probably benign Het
Rab6b T C 9: 103,167,124 S172P probably benign Het
Ror1 T A 4: 100,333,620 L58* probably null Het
Sec23b A G 2: 144,590,338 D756G possibly damaging Het
Slc24a2 T A 4: 87,032,275 K428N probably damaging Het
Spen C A 4: 141,475,752 V1855L probably benign Het
Srgap1 G A 10: 121,785,445 P1071S possibly damaging Het
Tns1 A G 1: 73,941,969 C1079R probably damaging Het
Traf3ip1 G T 1: 91,518,319 probably null Het
Trmt2a T C 16: 18,249,709 F82S probably damaging Het
Xrn1 A G 9: 96,039,737 D1401G probably damaging Het
Zfp352 T A 4: 90,224,156 S178T possibly damaging Het
Zfp758 G T 17: 22,375,759 E409* probably null Het
Other mutations in Olfr867
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02138:Olfr867 APN 9 20054900 missense probably benign 0.01
IGL03130:Olfr867 APN 9 20055372 missense probably benign 0.34
R1238:Olfr867 UTSW 9 20055461 start codon destroyed probably benign 0.12
R1412:Olfr867 UTSW 9 20055415 missense possibly damaging 0.65
R1625:Olfr867 UTSW 9 20055382 missense probably damaging 1.00
R1689:Olfr867 UTSW 9 20055126 missense possibly damaging 0.94
R2060:Olfr867 UTSW 9 20054596 missense probably damaging 1.00
R2204:Olfr867 UTSW 9 20055211 missense possibly damaging 0.74
R2350:Olfr867 UTSW 9 20055088 missense probably damaging 1.00
R3901:Olfr867 UTSW 9 20054873 missense probably benign 0.00
R5637:Olfr867 UTSW 9 20054983 missense possibly damaging 0.80
R6084:Olfr867 UTSW 9 20054883 missense possibly damaging 0.71
R6150:Olfr867 UTSW 9 20054874 missense probably benign 0.22
R6602:Olfr867 UTSW 9 20055046 missense probably benign 0.01
R6902:Olfr867 UTSW 9 20055374 missense possibly damaging 0.47
R6946:Olfr867 UTSW 9 20055374 missense possibly damaging 0.47
R7085:Olfr867 UTSW 9 20054936 missense probably benign 0.37
R7678:Olfr867 UTSW 9 20054605 missense probably damaging 1.00
R8034:Olfr867 UTSW 9 20055005 missense probably benign 0.01
R9194:Olfr867 UTSW 9 20055247 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGACTGCATGTTCACTAGCATCTTT -3'
(R):5'- ACCACAGCTCAACATTTACTTTTGGACT -3'

Sequencing Primer
(F):5'- CACTAGCATCTTTGGTATTGTCG -3'
(R):5'- CTACACACATTTAAGAATGGTCAGG -3'
Posted On 2014-01-05