Mutagenetix > Incidental Mutations

Incidental Mutation 'R1034:Gm1110'

95426

Institutional Source

Beutler Lab

Gene Symbol

Gm1110

Ensembl Gene

ENSMUSG00000079644

Gene Name

predicted gene 1110

Synonyms

LOC382064

MMRRC Submission

039133-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.077) question?

Stock #

R1034 (G1)

Quality Score

157

Status

Not validated

Chromosome

Chromosomal Location

26879567-26923111 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 26921350 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 16 (S16P)

Ref Sequence

ENSEMBL: ENSMUSP00000110916 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115261]

AlphaFold

F6Y113

Predicted Effect

probably damaging
Transcript: ENSMUST00000115261
AA Change: S16P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000110916
Gene: ENSMUSG00000079644
AA Change: S16P

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Glyco_hydro_35	55	368	2e-93	PFAM
Pfam:Glyco_hydro_42	70	229	1e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214461

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217197

Coding Region Coverage

1x: 98.7%
3x: 97.3%
10x: 92.9%
20x: 82.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	G	A	5: 76,876,283	T174M	probably damaging	Het
Abca14	T	C	7: 120,216,147	F206S	probably damaging	Het
Arid2	T	C	15: 96,369,505	V622A	probably benign	Het
Asic1	T	A	15: 99,698,058	L437Q	probably damaging	Het
Atp1b1	C	T	1: 164,453,488		probably null	Het
B3gnt5	A	G	16: 19,769,484	Y151C	probably damaging	Het
Cbx4	A	G	11: 119,081,707	S281P	probably damaging	Het
Dnah5	G	A	15: 28,302,471	V1625I	probably damaging	Het
Eftud2	A	C	11: 102,849,184	D461E	probably benign	Het
Epgn	A	G	5: 91,032,221	Y74C	probably damaging	Het
Fcho1	C	T	8: 71,712,560	A418T	probably benign	Het
Fgf14	C	T	14: 124,132,534	V113I	probably damaging	Het
Ggcx	G	A	6: 72,414,831	R68H	probably damaging	Het
Gm6729	T	C	10: 86,540,026		noncoding transcript	Het
Gpr108	A	G	17: 57,235,995	F522S	probably damaging	Het
Gpr156	T	C	16: 38,004,726	V435A	probably benign	Het
Khdrbs2	T	C	1: 32,467,791	L172P	probably damaging	Het
Kmo	C	T	1: 175,651,618	P240L	possibly damaging	Het
Ltn1	A	T	16: 87,397,137		probably null	Het
Nbeal1	T	A	1: 60,290,006	Y2194*	probably null	Het
Olfr767	T	A	10: 129,079,961	M1L	probably benign	Het
Olfr867	A	T	9: 20,055,365	S33T	probably benign	Het
Rab6b	T	C	9: 103,167,124	S172P	probably benign	Het
Ror1	T	A	4: 100,333,620	L58*	probably null	Het
Sec23b	A	G	2: 144,590,338	D756G	possibly damaging	Het
Slc24a2	T	A	4: 87,032,275	K428N	probably damaging	Het
Spen	C	A	4: 141,475,752	V1855L	probably benign	Het
Srgap1	G	A	10: 121,785,445	P1071S	possibly damaging	Het
Tns1	A	G	1: 73,941,969	C1079R	probably damaging	Het
Traf3ip1	G	T	1: 91,518,319		probably null	Het
Trmt2a	T	C	16: 18,249,709	F82S	probably damaging	Het
Xrn1	A	G	9: 96,039,737	D1401G	probably damaging	Het
Zfp352	T	A	4: 90,224,156	S178T	possibly damaging	Het
Zfp758	G	T	17: 22,375,759	E409*	probably null	Het

Other mutations in Gm1110

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00591:Gm1110	APN	9	26880874	nonsense	probably null
IGL01089:Gm1110	APN	9	26881860	missense	probably benign
IGL01631:Gm1110	APN	9	26897916	critical splice donor site	probably null
IGL02008:Gm1110	APN	9	26883230	missense	probably benign	0.09
IGL02331:Gm1110	APN	9	26913287	critical splice donor site	probably null
IGL02335:Gm1110	APN	9	26881763	missense	probably benign	0.00
IGL02550:Gm1110	APN	9	26881834	missense	probably benign	0.09
IGL02614:Gm1110	APN	9	26920714	missense	probably benign	0.11
IGL03409:Gm1110	APN	9	26896620	missense	probably benign	0.21
PIT4458001:Gm1110	UTSW	9	26880828	missense	probably benign	0.00
R0189:Gm1110	UTSW	9	26883218	missense	probably null	0.99
R0271:Gm1110	UTSW	9	26920666	missense	probably damaging	1.00
R1229:Gm1110	UTSW	9	26881806	missense	probably benign
R1355:Gm1110	UTSW	9	26883761	missense	probably benign	0.01
R1566:Gm1110	UTSW	9	26880870	missense	probably damaging	1.00
R1574:Gm1110	UTSW	9	26881126	splice site	probably benign
R1916:Gm1110	UTSW	9	26889638	missense	probably damaging	1.00
R2011:Gm1110	UTSW	9	26894258	missense	probably benign	0.01
R2214:Gm1110	UTSW	9	26902490	missense	probably benign	0.37
R2567:Gm1110	UTSW	9	26920696	missense	probably benign
R2967:Gm1110	UTSW	9	26881043	missense	probably benign	0.05
R4271:Gm1110	UTSW	9	26895648	critical splice donor site	probably null
R4683:Gm1110	UTSW	9	26920594	missense	probably damaging	0.99
R4945:Gm1110	UTSW	9	26920595	missense	possibly damaging	0.46
R5015:Gm1110	UTSW	9	26881866	missense	probably benign	0.01
R5089:Gm1110	UTSW	9	26882387	missense	probably damaging	0.96
R5225:Gm1110	UTSW	9	26902478	missense	probably damaging	1.00
R5239:Gm1110	UTSW	9	26893570	missense	probably benign	0.00
R5395:Gm1110	UTSW	9	26889632	missense	probably benign
R5783:Gm1110	UTSW	9	26882336	missense	probably benign
R6045:Gm1110	UTSW	9	26883209	critical splice donor site	probably null
R6245:Gm1110	UTSW	9	26920747	missense	probably benign	0.04
R6357:Gm1110	UTSW	9	26914128	splice site	probably null
R6863:Gm1110	UTSW	9	26881064	missense	probably damaging	1.00
R7336:Gm1110	UTSW	9	26914357	missense	probably damaging	0.99
R7454:Gm1110	UTSW	9	26920649	missense	probably benign
R7555:Gm1110	UTSW	9	26893628	missense	probably benign	0.05
R7579:Gm1110	UTSW	9	26883826	missense	possibly damaging	0.93
R7990:Gm1110	UTSW	9	26880841	missense	possibly damaging	0.66
R8062:Gm1110	UTSW	9	26881821	missense	probably damaging	0.99
R8108:Gm1110	UTSW	9	26920661	missense	probably damaging	1.00
R8323:Gm1110	UTSW	9	26902423	critical splice donor site	probably null
R8354:Gm1110	UTSW	9	26883280	missense	probably benign	0.01
R8354:Gm1110	UTSW	9	26883281	missense	probably benign	0.00
R8454:Gm1110	UTSW	9	26883280	missense	probably benign	0.01
R8454:Gm1110	UTSW	9	26883281	missense	probably benign	0.00
R8494:Gm1110	UTSW	9	26880858	missense	probably benign	0.04
RF002:Gm1110	UTSW	9	26920640	missense	probably damaging	1.00
X0063:Gm1110	UTSW	9	26894280	missense	probably benign	0.01
Z1088:Gm1110	UTSW	9	26913310	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TCAAGGTCAGCCTCAGATGCAAAG -3'
(R):5'- AGCAATTCCTCCTCCAGTCAGCAG -3'

Sequencing Primer
(F):5'- agggaaaggaaaagaaagaaagag -3'
(R):5'- TAGGAACAAATTCTGCTTTCCCAAC -3'

Posted On

2014-01-05