Incidental Mutation 'R1034:Xrn1'
ID 95431
Institutional Source Beutler Lab
Gene Symbol Xrn1
Ensembl Gene ENSMUSG00000032410
Gene Name 5'-3' exoribonuclease 1
Synonyms Dhm2, mXrn1
MMRRC Submission 039133-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.911) question?
Stock # R1034 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 95954760-96057803 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 96039737 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1401 (D1401G)
Ref Sequence ENSEMBL: ENSMUSP00000034981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034981] [ENSMUST00000185633]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000034981
AA Change: D1401G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034981
Gene: ENSMUSG00000032410
AA Change: D1401G

DomainStartEndE-ValueType
Pfam:XRN_N 1 227 8.4e-99 PFAM
low complexity region 372 389 N/A INTRINSIC
low complexity region 414 430 N/A INTRINSIC
low complexity region 662 673 N/A INTRINSIC
low complexity region 1054 1066 N/A INTRINSIC
low complexity region 1555 1566 N/A INTRINSIC
low complexity region 1665 1684 N/A INTRINSIC
low complexity region 1696 1711 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000185633
AA Change: D1401G

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140278
Gene: ENSMUSG00000032410
AA Change: D1401G

DomainStartEndE-ValueType
Pfam:XRN_N 1 228 1.2e-103 PFAM
low complexity region 372 389 N/A INTRINSIC
low complexity region 414 430 N/A INTRINSIC
low complexity region 662 673 N/A INTRINSIC
low complexity region 1054 1066 N/A INTRINSIC
low complexity region 1551 1562 N/A INTRINSIC
low complexity region 1661 1680 N/A INTRINSIC
low complexity region 1692 1707 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189281
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.3%
  • 10x: 92.9%
  • 20x: 82.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the 5'-3' exonuclease family. The encoded protein may be involved in replication-dependent histone mRNA degradation, and interacts directly with the enhancer of mRNA-decapping protein 4. In addition to mRNA metabolism, a similar protein in yeast has been implicated in a variety of nuclear and cytoplasmic functions, including homologous recombination, meiosis, telomere maintenance, and microtubule assembly. Mutations in this gene are associated with osteosarcoma, suggesting that the encoded protein may also play a role in bone formation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Abca14 T C 7: 120,216,147 F206S probably damaging Het
Arid2 T C 15: 96,369,505 V622A probably benign Het
Asic1 T A 15: 99,698,058 L437Q probably damaging Het
Atp1b1 C T 1: 164,453,488 probably null Het
B3gnt5 A G 16: 19,769,484 Y151C probably damaging Het
Cbx4 A G 11: 119,081,707 S281P probably damaging Het
Dnah5 G A 15: 28,302,471 V1625I probably damaging Het
Eftud2 A C 11: 102,849,184 D461E probably benign Het
Epgn A G 5: 91,032,221 Y74C probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fgf14 C T 14: 124,132,534 V113I probably damaging Het
Ggcx G A 6: 72,414,831 R68H probably damaging Het
Gm1110 A G 9: 26,921,350 S16P probably damaging Het
Gm6729 T C 10: 86,540,026 noncoding transcript Het
Gpr108 A G 17: 57,235,995 F522S probably damaging Het
Gpr156 T C 16: 38,004,726 V435A probably benign Het
Khdrbs2 T C 1: 32,467,791 L172P probably damaging Het
Kmo C T 1: 175,651,618 P240L possibly damaging Het
Ltn1 A T 16: 87,397,137 probably null Het
Nbeal1 T A 1: 60,290,006 Y2194* probably null Het
Olfr767 T A 10: 129,079,961 M1L probably benign Het
Olfr867 A T 9: 20,055,365 S33T probably benign Het
Rab6b T C 9: 103,167,124 S172P probably benign Het
Ror1 T A 4: 100,333,620 L58* probably null Het
Sec23b A G 2: 144,590,338 D756G possibly damaging Het
Slc24a2 T A 4: 87,032,275 K428N probably damaging Het
Spen C A 4: 141,475,752 V1855L probably benign Het
Srgap1 G A 10: 121,785,445 P1071S possibly damaging Het
Tns1 A G 1: 73,941,969 C1079R probably damaging Het
Traf3ip1 G T 1: 91,518,319 probably null Het
Trmt2a T C 16: 18,249,709 F82S probably damaging Het
Zfp352 T A 4: 90,224,156 S178T possibly damaging Het
Zfp758 G T 17: 22,375,759 E409* probably null Het
Other mutations in Xrn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Xrn1 APN 9 96038949 missense probably benign 0.05
IGL00778:Xrn1 APN 9 95973447 splice site probably benign
IGL01936:Xrn1 APN 9 96048344 missense probably damaging 0.98
IGL01983:Xrn1 APN 9 95973368 critical splice donor site probably null
IGL02106:Xrn1 APN 9 95977805 missense probably benign 0.28
IGL02330:Xrn1 APN 9 95973348 nonsense probably null
IGL02338:Xrn1 APN 9 95977827 missense probably benign 0.42
IGL02830:Xrn1 APN 9 96018181 critical splice donor site probably null
R0063:Xrn1 UTSW 9 95969535 missense probably damaging 1.00
R0063:Xrn1 UTSW 9 95969535 missense probably damaging 1.00
R0467:Xrn1 UTSW 9 96024191 missense probably damaging 1.00
R0508:Xrn1 UTSW 9 96051736 missense probably benign 0.00
R0605:Xrn1 UTSW 9 96026877 nonsense probably null
R0670:Xrn1 UTSW 9 95991056 missense probably damaging 1.00
R0691:Xrn1 UTSW 9 95973539 missense probably damaging 0.96
R0781:Xrn1 UTSW 9 95991269 missense probably benign 0.00
R0947:Xrn1 UTSW 9 95998263 missense possibly damaging 0.60
R1124:Xrn1 UTSW 9 96003865 missense probably benign 0.02
R1171:Xrn1 UTSW 9 95991011 missense possibly damaging 0.47
R1199:Xrn1 UTSW 9 95981761 splice site probably benign
R1609:Xrn1 UTSW 9 95974893 missense probably benign 0.03
R1921:Xrn1 UTSW 9 95999497 missense probably benign 0.04
R1953:Xrn1 UTSW 9 96024221 critical splice donor site probably null
R2000:Xrn1 UTSW 9 96045563 nonsense probably null
R2109:Xrn1 UTSW 9 95979220 missense probably benign 0.13
R2111:Xrn1 UTSW 9 96039832 missense probably benign 0.03
R2164:Xrn1 UTSW 9 96006820 missense possibly damaging 0.95
R2266:Xrn1 UTSW 9 96006712 missense possibly damaging 0.64
R3754:Xrn1 UTSW 9 95967788 missense probably damaging 1.00
R3783:Xrn1 UTSW 9 95969285 missense probably benign 0.10
R3921:Xrn1 UTSW 9 95969284 missense probably benign 0.01
R3929:Xrn1 UTSW 9 95988873 missense possibly damaging 0.89
R4011:Xrn1 UTSW 9 95985225 nonsense probably null
R4082:Xrn1 UTSW 9 95981920 missense probably benign 0.02
R4455:Xrn1 UTSW 9 95973645 intron probably benign
R4736:Xrn1 UTSW 9 96033636 missense probably damaging 1.00
R4756:Xrn1 UTSW 9 96039809 missense probably benign 0.00
R4780:Xrn1 UTSW 9 95974744 intron probably benign
R5152:Xrn1 UTSW 9 95964065 missense probably benign 0.40
R5261:Xrn1 UTSW 9 96045543 missense probably benign 0.00
R5741:Xrn1 UTSW 9 96045551 missense probably benign 0.24
R6108:Xrn1 UTSW 9 95974427 missense possibly damaging 0.91
R6127:Xrn1 UTSW 9 95969489 missense probably damaging 0.99
R6268:Xrn1 UTSW 9 95964014 missense probably damaging 1.00
R6418:Xrn1 UTSW 9 96033710 splice site probably null
R7002:Xrn1 UTSW 9 96047790 missense probably benign 0.00
R7067:Xrn1 UTSW 9 95969512 missense probably damaging 0.98
R7155:Xrn1 UTSW 9 95979145 missense possibly damaging 0.92
R7439:Xrn1 UTSW 9 96051629 missense probably benign
R7447:Xrn1 UTSW 9 96045494 missense probably benign
R7454:Xrn1 UTSW 9 96048358 missense probably benign 0.03
R7473:Xrn1 UTSW 9 95979141 missense probably benign 0.07
R7561:Xrn1 UTSW 9 95999458 missense probably benign 0.18
R7580:Xrn1 UTSW 9 96011679 missense not run
R7642:Xrn1 UTSW 9 96021853 missense possibly damaging 0.95
R7763:Xrn1 UTSW 9 95998348 critical splice donor site probably null
R8225:Xrn1 UTSW 9 96035667 missense probably benign
R8372:Xrn1 UTSW 9 96024113 missense probably benign 0.42
R8516:Xrn1 UTSW 9 96048391 nonsense probably null
R8710:Xrn1 UTSW 9 96002232 missense
R8850:Xrn1 UTSW 9 96038679 missense probably benign
R8865:Xrn1 UTSW 9 95991193 missense probably benign 0.00
R8951:Xrn1 UTSW 9 95988946 missense probably benign 0.00
R9013:Xrn1 UTSW 9 96038928 missense probably benign 0.00
R9162:Xrn1 UTSW 9 96033607 missense probably benign 0.01
R9163:Xrn1 UTSW 9 95998221 missense probably benign 0.00
R9415:Xrn1 UTSW 9 95969474 missense probably damaging 1.00
R9438:Xrn1 UTSW 9 96011234 missense probably benign 0.30
R9544:Xrn1 UTSW 9 96038703 missense probably benign
R9588:Xrn1 UTSW 9 96038703 missense probably benign
R9674:Xrn1 UTSW 9 95973592 missense probably damaging 0.99
R9674:Xrn1 UTSW 9 95973594 missense possibly damaging 0.65
R9716:Xrn1 UTSW 9 96045579 missense possibly damaging 0.71
Z1176:Xrn1 UTSW 9 95964190 missense probably damaging 1.00
Z1177:Xrn1 UTSW 9 95991005 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCCATTAGACCACAGAGTCCTGC -3'
(R):5'- GGACATGACCCTGACTATTGGCAAC -3'

Sequencing Primer
(F):5'- agccatctctccagccc -3'
(R):5'- CCTGACTATTGGCAACGGGAG -3'
Posted On 2014-01-05