Incidental Mutation 'R1034:Gm6729'
ID95436
Institutional Source Beutler Lab
Gene Symbol Gm6729
Ensembl Gene ENSMUSG00000090816
Gene Namepredicted gene 6729
Synonyms
MMRRC Submission 039133-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R1034 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location86539883-86541334 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 86540026 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165173
SMART Domains Protein: ENSMUSP00000133178
Gene: ENSMUSG00000090816

DomainStartEndE-ValueType
S_TKc 14 262 4.3e-87 SMART
UBA 276 313 2.99e-4 SMART
low complexity region 327 341 N/A INTRINSIC
low complexity region 450 465 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219485
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.3%
  • 10x: 92.9%
  • 20x: 82.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Abca14 T C 7: 120,216,147 F206S probably damaging Het
Arid2 T C 15: 96,369,505 V622A probably benign Het
Asic1 T A 15: 99,698,058 L437Q probably damaging Het
Atp1b1 C T 1: 164,453,488 probably null Het
B3gnt5 A G 16: 19,769,484 Y151C probably damaging Het
Cbx4 A G 11: 119,081,707 S281P probably damaging Het
Dnah5 G A 15: 28,302,471 V1625I probably damaging Het
Eftud2 A C 11: 102,849,184 D461E probably benign Het
Epgn A G 5: 91,032,221 Y74C probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fgf14 C T 14: 124,132,534 V113I probably damaging Het
Ggcx G A 6: 72,414,831 R68H probably damaging Het
Gm1110 A G 9: 26,921,350 S16P probably damaging Het
Gpr108 A G 17: 57,235,995 F522S probably damaging Het
Gpr156 T C 16: 38,004,726 V435A probably benign Het
Khdrbs2 T C 1: 32,467,791 L172P probably damaging Het
Kmo C T 1: 175,651,618 P240L possibly damaging Het
Ltn1 A T 16: 87,397,137 probably null Het
Nbeal1 T A 1: 60,290,006 Y2194* probably null Het
Olfr767 T A 10: 129,079,961 M1L probably benign Het
Olfr867 A T 9: 20,055,365 S33T probably benign Het
Rab6b T C 9: 103,167,124 S172P probably benign Het
Ror1 T A 4: 100,333,620 L58* probably null Het
Sec23b A G 2: 144,590,338 D756G possibly damaging Het
Slc24a2 T A 4: 87,032,275 K428N probably damaging Het
Spen C A 4: 141,475,752 V1855L probably benign Het
Srgap1 G A 10: 121,785,445 P1071S possibly damaging Het
Tns1 A G 1: 73,941,969 C1079R probably damaging Het
Traf3ip1 G T 1: 91,518,319 probably null Het
Trmt2a T C 16: 18,249,709 F82S probably damaging Het
Xrn1 A G 9: 96,039,737 D1401G probably damaging Het
Zfp352 T A 4: 90,224,156 S178T possibly damaging Het
Zfp758 G T 17: 22,375,759 E409* probably null Het
Other mutations in Gm6729
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0906:Gm6729 UTSW 10 86540592 unclassified noncoding transcript
R1052:Gm6729 UTSW 10 86540935 unclassified noncoding transcript
R1523:Gm6729 UTSW 10 86540175 unclassified noncoding transcript
R1922:Gm6729 UTSW 10 86540918 unclassified noncoding transcript
R3498:Gm6729 UTSW 10 86540718 unclassified noncoding transcript
R4133:Gm6729 UTSW 10 86541166 unclassified noncoding transcript
R4193:Gm6729 UTSW 10 86540619 unclassified noncoding transcript
R4940:Gm6729 UTSW 10 86540388 unclassified noncoding transcript
X0028:Gm6729 UTSW 10 86540784 unclassified noncoding transcript
Predicted Primers PCR Primer
(F):5'- TTCAGAGCTGAGATGTACCCTCCC -3'
(R):5'- AGTGAACCCAACTTTGGCCTCCTC -3'

Sequencing Primer
(F):5'- TGAGATGTACCCTCCCATATTTG -3'
(R):5'- TGCCACTATCAGGACACAAGTTG -3'
Posted On2014-01-05