Mutagenetix > Incidental Mutation

Incidental Mutation 'R1034:Srgap1'

95440

Institutional Source

Beutler Lab

Gene Symbol

Srgap1

Ensembl Gene

ENSMUSG00000020121

Gene Name

SLIT-ROBO Rho GTPase activating protein 1

Synonyms

Arhgap13, 4930572H05Rik

MMRRC Submission

039133-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.190) question?

Stock #

R1034 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

121780991-122047315 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 121785445 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 1071 (P1071S)

Ref Sequence

ENSEMBL: ENSMUSP00000080389 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020322] [ENSMUST00000081688]

AlphaFold

Q91Z69

Predicted Effect

probably benign
Transcript: ENSMUST00000020322
AA Change: P1048S

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000020322
Gene: ENSMUSG00000020121
AA Change: P1048S

Domain	Start	End	E-Value	Type
FCH	22	121	3.81e-16	SMART
low complexity region	173	193	N/A	INTRINSIC
coiled coil region	352	382	N/A	INTRINSIC
low complexity region	405	418	N/A	INTRINSIC
RhoGAP	494	668	1.27e-64	SMART
SH3	723	778	1.57e-14	SMART
low complexity region	826	840	N/A	INTRINSIC
low complexity region	1004	1014	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000081688
AA Change: P1071S

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000080389
Gene: ENSMUSG00000020121
AA Change: P1071S

Domain	Start	End	E-Value	Type
FCH	22	121	3.81e-16	SMART
low complexity region	173	193	N/A	INTRINSIC
coiled coil region	352	382	N/A	INTRINSIC
low complexity region	405	418	N/A	INTRINSIC
RhoGAP	517	691	1.27e-64	SMART
SH3	746	801	1.57e-14	SMART
low complexity region	849	863	N/A	INTRINSIC
low complexity region	1027	1037	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161996

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188932

Coding Region Coverage

1x: 98.7%
3x: 97.3%
10x: 92.9%
20x: 82.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase activator, working with the GTPase CDC42 to negatively regulate neuronal migration. The encoded protein interacts with the transmembrane receptor ROBO1 to inactivate CDC42. [provided by RefSeq, Sep 2016]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	G	A	5: 76,876,283	T174M	probably damaging	Het
Abca14	T	C	7: 120,216,147	F206S	probably damaging	Het
Arid2	T	C	15: 96,369,505	V622A	probably benign	Het
Asic1	T	A	15: 99,698,058	L437Q	probably damaging	Het
Atp1b1	C	T	1: 164,453,488		probably null	Het
B3gnt5	A	G	16: 19,769,484	Y151C	probably damaging	Het
Cbx4	A	G	11: 119,081,707	S281P	probably damaging	Het
Dnah5	G	A	15: 28,302,471	V1625I	probably damaging	Het
Eftud2	A	C	11: 102,849,184	D461E	probably benign	Het
Epgn	A	G	5: 91,032,221	Y74C	probably damaging	Het
Fcho1	C	T	8: 71,712,560	A418T	probably benign	Het
Fgf14	C	T	14: 124,132,534	V113I	probably damaging	Het
Ggcx	G	A	6: 72,414,831	R68H	probably damaging	Het
Gm1110	A	G	9: 26,921,350	S16P	probably damaging	Het
Gm6729	T	C	10: 86,540,026		noncoding transcript	Het
Gpr108	A	G	17: 57,235,995	F522S	probably damaging	Het
Gpr156	T	C	16: 38,004,726	V435A	probably benign	Het
Khdrbs2	T	C	1: 32,467,791	L172P	probably damaging	Het
Kmo	C	T	1: 175,651,618	P240L	possibly damaging	Het
Ltn1	A	T	16: 87,397,137		probably null	Het
Nbeal1	T	A	1: 60,290,006	Y2194*	probably null	Het
Olfr767	T	A	10: 129,079,961	M1L	probably benign	Het
Olfr867	A	T	9: 20,055,365	S33T	probably benign	Het
Rab6b	T	C	9: 103,167,124	S172P	probably benign	Het
Ror1	T	A	4: 100,333,620	L58*	probably null	Het
Sec23b	A	G	2: 144,590,338	D756G	possibly damaging	Het
Slc24a2	T	A	4: 87,032,275	K428N	probably damaging	Het
Spen	C	A	4: 141,475,752	V1855L	probably benign	Het
Tns1	A	G	1: 73,941,969	C1079R	probably damaging	Het
Traf3ip1	G	T	1: 91,518,319		probably null	Het
Trmt2a	T	C	16: 18,249,709	F82S	probably damaging	Het
Xrn1	A	G	9: 96,039,737	D1401G	probably damaging	Het
Zfp352	T	A	4: 90,224,156	S178T	possibly damaging	Het
Zfp758	G	T	17: 22,375,759	E409*	probably null	Het

Other mutations in Srgap1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01964:Srgap1	APN	10	121804966	missense	possibly damaging	0.81
IGL02106:Srgap1	APN	10	121785693	missense	possibly damaging	0.95
IGL02927:Srgap1	APN	10	121855462	missense	probably damaging	0.99
IGL03088:Srgap1	APN	10	121825693	missense	possibly damaging	0.94
IGL03208:Srgap1	APN	10	121792266	missense	possibly damaging	0.89
IGL03251:Srgap1	APN	10	121804921	splice site	probably null
PIT1430001:Srgap1	UTSW	10	121896753	splice site	probably benign
R0052:Srgap1	UTSW	10	121800827	missense	possibly damaging	0.94
R0052:Srgap1	UTSW	10	121800827	missense	possibly damaging	0.94
R0356:Srgap1	UTSW	10	121855536	splice site	probably null
R0361:Srgap1	UTSW	10	122047192	start codon destroyed	probably null	0.89
R0365:Srgap1	UTSW	10	121785705	missense	possibly damaging	0.80
R0675:Srgap1	UTSW	10	121792235	missense	probably damaging	1.00
R0801:Srgap1	UTSW	10	121807875	missense	probably damaging	0.96
R0815:Srgap1	UTSW	10	121785474	missense	probably damaging	0.99
R1160:Srgap1	UTSW	10	121855477	missense	probably benign	0.01
R1454:Srgap1	UTSW	10	121896738	missense	probably damaging	0.99
R1624:Srgap1	UTSW	10	121855373	missense	probably benign	0.03
R1628:Srgap1	UTSW	10	121870339	missense	probably benign	0.15
R1816:Srgap1	UTSW	10	121925971	nonsense	probably null
R1933:Srgap1	UTSW	10	121925903	missense	possibly damaging	0.89
R2034:Srgap1	UTSW	10	121792746	missense	probably damaging	0.98
R2211:Srgap1	UTSW	10	121853740	missense	possibly damaging	0.55
R2295:Srgap1	UTSW	10	121794760	missense	probably benign	0.03
R2368:Srgap1	UTSW	10	121829289	missense	probably benign	0.05
R3796:Srgap1	UTSW	10	122047132	missense	probably benign	0.06
R4083:Srgap1	UTSW	10	121785690	missense	probably damaging	1.00
R4172:Srgap1	UTSW	10	121855363	missense	probably benign	0.00
R4322:Srgap1	UTSW	10	121869806	missense	probably damaging	1.00
R4401:Srgap1	UTSW	10	121804921	splice site	probably null
R4513:Srgap1	UTSW	10	121870326	critical splice donor site	probably null
R4698:Srgap1	UTSW	10	121792487	missense	probably benign	0.22
R4776:Srgap1	UTSW	10	121792351	missense	probably benign	0.03
R4951:Srgap1	UTSW	10	121785552	missense	probably benign	0.20
R5116:Srgap1	UTSW	10	121792379	missense	possibly damaging	0.77
R5232:Srgap1	UTSW	10	121840911	missense	probably benign	0.00
R5237:Srgap1	UTSW	10	121807883	missense	probably damaging	1.00
R5335:Srgap1	UTSW	10	121785377	utr 3 prime	probably benign
R5402:Srgap1	UTSW	10	121785760	missense	probably benign	0.06
R5432:Srgap1	UTSW	10	121869823	missense	probably damaging	1.00
R5456:Srgap1	UTSW	10	121869811	missense	probably benign	0.45
R5669:Srgap1	UTSW	10	121804850	missense	probably benign	0.00
R5682:Srgap1	UTSW	10	121805014	missense	probably damaging	1.00
R5687:Srgap1	UTSW	10	121825636	missense	probably damaging	1.00
R5773:Srgap1	UTSW	10	121896709	missense	probably benign	0.02
R5832:Srgap1	UTSW	10	121840914	missense	probably damaging	1.00
R6028:Srgap1	UTSW	10	121828730	missense	probably null
R6240:Srgap1	UTSW	10	122047156	missense	probably benign	0.06
R6336:Srgap1	UTSW	10	121925941	missense	probably benign	0.01
R6435:Srgap1	UTSW	10	121800827	missense	possibly damaging	0.94
R6597:Srgap1	UTSW	10	121792371	missense	probably benign	0.11
R6798:Srgap1	UTSW	10	121925904	missense	probably damaging	1.00
R6807:Srgap1	UTSW	10	121828726	splice site	probably null
R6897:Srgap1	UTSW	10	121785618	missense	probably damaging	0.96
R7057:Srgap1	UTSW	10	121804953	missense	probably benign	0.20
R7196:Srgap1	UTSW	10	121840848	missense	probably benign	0.00
R7247:Srgap1	UTSW	10	121869790	missense	probably damaging	0.98
R7404:Srgap1	UTSW	10	121785745	missense	probably benign	0.18
R7467:Srgap1	UTSW	10	121855439	nonsense	probably null
R7792:Srgap1	UTSW	10	121925967	missense	probably damaging	0.98
R7846:Srgap1	UTSW	10	121785492	missense	probably damaging	0.97
R7896:Srgap1	UTSW	10	121853553	critical splice donor site	probably benign
R7912:Srgap1	UTSW	10	121853553	critical splice donor site	probably benign
R8127:Srgap1	UTSW	10	121855366	missense	probably null	0.04
R8233:Srgap1	UTSW	10	121825436	missense	probably damaging	1.00
R8248:Srgap1	UTSW	10	121804817	missense	probably damaging	0.99
R8362:Srgap1	UTSW	10	121855478	missense	possibly damaging	0.46
R8885:Srgap1	UTSW	10	121925640	intron	probably benign
R9074:Srgap1	UTSW	10	121792352	missense	probably damaging	0.99
R9134:Srgap1	UTSW	10	122047222	start gained	probably benign
R9338:Srgap1	UTSW	10	121853553	critical splice donor site	probably benign
R9437:Srgap1	UTSW	10	121800872	missense	probably benign	0.18
R9629:Srgap1	UTSW	10	121869841	missense	probably benign	0.06
R9747:Srgap1	UTSW	10	121792674	missense	probably benign
R9747:Srgap1	UTSW	10	121925866	missense	probably damaging	1.00
X0063:Srgap1	UTSW	10	121785412	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TCCAGTTATAAGCGCAAGACCAAGG -3'
(R):5'- TAGAGTCAACCCAGATGCACGAGG -3'

Sequencing Primer
(F):5'- GAAGGTTGTGGATCACCCACTC -3'
(R):5'- GAGACCATGAACACTGCTTTG -3'

Posted On

2014-01-05