Incidental Mutation 'R1120:Disp1'
ID 95443
Institutional Source Beutler Lab
Gene Symbol Disp1
Ensembl Gene ENSMUSG00000030768
Gene Name dispatched RND transporter family member 1
Synonyms DispA, 1190008H24Rik
MMRRC Submission 039193-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.929) question?
Stock # R1120 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 182867830-183003086 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 182880139 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 288 (D288G)
Ref Sequence ENSEMBL: ENSMUSP00000141747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003035] [ENSMUST00000171366] [ENSMUST00000195372]
AlphaFold Q3TDN0
Predicted Effect probably benign
Transcript: ENSMUST00000003035
AA Change: D288G

PolyPhen 2 Score 0.240 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000003035
Gene: ENSMUSG00000030768
AA Change: D288G

DomainStartEndE-ValueType
low complexity region 11 35 N/A INTRINSIC
low complexity region 71 89 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Pfam:Patched 279 765 6.8e-20 PFAM
Pfam:MMPL 496 691 6.6e-13 PFAM
Pfam:Sterol-sensing 518 670 1.7e-15 PFAM
Pfam:Patched 916 1130 8e-11 PFAM
Pfam:MMPL 937 1144 3.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171366
AA Change: D288G

PolyPhen 2 Score 0.240 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000126742
Gene: ENSMUSG00000030768
AA Change: D288G

DomainStartEndE-ValueType
low complexity region 11 35 N/A INTRINSIC
low complexity region 71 89 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Pfam:Patched 272 766 2.6e-20 PFAM
Pfam:MMPL 496 691 6.6e-13 PFAM
Pfam:Sterol-sensing 516 671 2.2e-15 PFAM
Pfam:Patched 921 1130 8.7e-11 PFAM
Pfam:MMPL 937 1144 3.9e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192915
Predicted Effect probably benign
Transcript: ENSMUST00000195372
AA Change: D288G

PolyPhen 2 Score 0.240 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000141747
Gene: ENSMUSG00000030768
AA Change: D288G

DomainStartEndE-ValueType
low complexity region 11 35 N/A INTRINSIC
low complexity region 71 89 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Pfam:Patched 272 766 2.6e-20 PFAM
Pfam:MMPL 496 691 6.6e-13 PFAM
Pfam:Sterol-sensing 516 671 2.2e-15 PFAM
Pfam:Patched 921 1130 8.7e-11 PFAM
Pfam:MMPL 937 1144 3.9e-9 PFAM
Meta Mutation Damage Score 0.0773 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in a graded manner according to the effective concentration of the signal, and this response produces the pattern of cell types constituting the mature structure. A novel segment-polarity gene known as dispatched has been identified in Drosophila and its protein product is required for normal Hedgehog (Hh) signaling. This gene is one of two human homologs of Drosophila dispatched and, based on sequence identity to its mouse counterpart, the encoded protein may play an essential role in Hh patterning activities in the early embryo. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted and chemically induced mutations exhibit a dorsalized neural tube, impaired heart looping, pericardial edema, large forelimbs, and abnormal head shape. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T G 5: 24,613,818 (GRCm39) probably null Het
Akp3 A T 1: 87,053,159 (GRCm39) Q77L probably damaging Het
Blm A G 7: 80,131,214 (GRCm39) L878S probably damaging Het
Cabin1 A G 10: 75,561,550 (GRCm39) Y984H probably damaging Het
Cadps2 T C 6: 23,838,793 (GRCm39) Q86R probably damaging Het
Cd2 C T 3: 101,194,804 (GRCm39) D95N probably damaging Het
Cd36 A G 5: 17,990,826 (GRCm39) I438T possibly damaging Het
Crhbp G T 13: 95,578,593 (GRCm39) T176K probably benign Het
D630045J12Rik G T 6: 38,171,705 (GRCm39) T821K probably damaging Het
Dsc3 A G 18: 20,120,034 (GRCm39) V208A probably benign Het
Eef1e1 A T 13: 38,842,910 (GRCm39) N20K probably damaging Het
Ercc5 A G 1: 44,201,001 (GRCm39) D187G probably damaging Het
Etl4 T A 2: 20,811,514 (GRCm39) M1199K probably benign Het
Fnbp1 A T 2: 30,926,606 (GRCm39) Y433N probably damaging Het
Fxyd3 A G 7: 30,770,803 (GRCm39) probably benign Het
Hfm1 A T 5: 107,052,084 (GRCm39) probably benign Het
Irak2 T A 6: 113,652,720 (GRCm39) probably benign Het
Jpt2 T C 17: 25,179,585 (GRCm39) M1V probably null Het
Knl1 A G 2: 118,892,856 (GRCm39) R51G probably damaging Het
Krtap8-1 A G 16: 89,284,753 (GRCm39) Y15H probably benign Het
Lrba A T 3: 86,202,499 (GRCm39) D250V probably damaging Het
Mgat4a A G 1: 37,491,662 (GRCm39) S357P probably damaging Het
Nup98 T A 7: 101,809,923 (GRCm39) T536S probably damaging Het
Or4a27 A G 2: 88,559,281 (GRCm39) Y221H probably damaging Het
Or4c109 A G 2: 88,818,423 (GRCm39) M41T possibly damaging Het
Or9k2 A G 10: 129,998,406 (GRCm39) L263P probably damaging Het
Parp14 G A 16: 35,677,130 (GRCm39) A946V probably benign Het
Pnpla8 A G 12: 44,351,730 (GRCm39) T568A possibly damaging Het
Ptprn A G 1: 75,234,825 (GRCm39) I254T probably benign Het
Rab5b A C 10: 128,515,483 (GRCm39) N188K probably benign Het
Samd5 A G 10: 9,504,792 (GRCm39) V154A possibly damaging Het
Smarcb1 A G 10: 75,757,157 (GRCm39) F25L probably benign Het
Smchd1 A T 17: 71,665,141 (GRCm39) Y1847* probably null Het
Smpd4 T C 16: 17,456,350 (GRCm39) probably benign Het
Tex14 T A 11: 87,429,502 (GRCm39) probably benign Het
Tnfrsf26 G A 7: 143,171,651 (GRCm39) R101C probably damaging Het
Trmu A G 15: 85,774,486 (GRCm39) K37E possibly damaging Het
Tsen54 C T 11: 115,705,839 (GRCm39) A52V probably damaging Het
Ubb T C 11: 62,443,009 (GRCm39) I13T possibly damaging Het
Vmn2r101 A T 17: 19,797,723 (GRCm39) probably benign Het
Other mutations in Disp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB006:Disp1 UTSW 1 182,917,103 (GRCm39) missense probably benign
BB016:Disp1 UTSW 1 182,917,103 (GRCm39) missense probably benign
R1482:Disp1 UTSW 1 182,868,038 (GRCm39) missense possibly damaging 0.61
R1655:Disp1 UTSW 1 182,868,568 (GRCm39) missense probably benign 0.01
R1660:Disp1 UTSW 1 182,869,306 (GRCm39) missense probably damaging 1.00
R1816:Disp1 UTSW 1 182,880,139 (GRCm39) missense probably damaging 0.99
R1835:Disp1 UTSW 1 182,870,564 (GRCm39) missense probably damaging 1.00
R1954:Disp1 UTSW 1 182,870,107 (GRCm39) missense probably damaging 0.99
R2025:Disp1 UTSW 1 182,869,767 (GRCm39) missense probably damaging 1.00
R2136:Disp1 UTSW 1 182,869,942 (GRCm39) missense probably damaging 1.00
R2150:Disp1 UTSW 1 182,869,936 (GRCm39) missense probably damaging 1.00
R2207:Disp1 UTSW 1 182,869,906 (GRCm39) missense possibly damaging 0.94
R2392:Disp1 UTSW 1 182,868,731 (GRCm39) missense probably benign
R2831:Disp1 UTSW 1 182,870,883 (GRCm39) small deletion probably benign
R3111:Disp1 UTSW 1 182,869,087 (GRCm39) missense probably damaging 1.00
R3116:Disp1 UTSW 1 182,870,486 (GRCm39) missense probably benign 0.01
R3160:Disp1 UTSW 1 182,868,806 (GRCm39) missense probably benign 0.09
R3161:Disp1 UTSW 1 182,868,806 (GRCm39) missense probably benign 0.09
R3162:Disp1 UTSW 1 182,868,806 (GRCm39) missense probably benign 0.09
R3162:Disp1 UTSW 1 182,868,806 (GRCm39) missense probably benign 0.09
R3716:Disp1 UTSW 1 182,869,315 (GRCm39) missense probably damaging 1.00
R3914:Disp1 UTSW 1 182,870,666 (GRCm39) missense probably benign 0.05
R4061:Disp1 UTSW 1 182,869,264 (GRCm39) missense probably damaging 0.96
R4191:Disp1 UTSW 1 182,870,737 (GRCm39) missense probably damaging 1.00
R4261:Disp1 UTSW 1 182,870,950 (GRCm39) missense probably damaging 1.00
R4272:Disp1 UTSW 1 182,869,208 (GRCm39) missense possibly damaging 0.95
R4273:Disp1 UTSW 1 182,869,208 (GRCm39) missense possibly damaging 0.95
R4351:Disp1 UTSW 1 182,881,542 (GRCm39) missense probably benign 0.01
R4672:Disp1 UTSW 1 182,880,215 (GRCm39) critical splice acceptor site probably null
R4764:Disp1 UTSW 1 182,869,660 (GRCm39) missense probably damaging 1.00
R4910:Disp1 UTSW 1 182,917,027 (GRCm39) missense probably damaging 1.00
R5150:Disp1 UTSW 1 182,871,063 (GRCm39) missense probably damaging 0.98
R5502:Disp1 UTSW 1 182,869,450 (GRCm39) missense probably damaging 1.00
R5616:Disp1 UTSW 1 182,869,913 (GRCm39) missense probably benign 0.30
R5699:Disp1 UTSW 1 182,870,119 (GRCm39) nonsense probably null
R5813:Disp1 UTSW 1 182,869,974 (GRCm39) missense probably damaging 1.00
R5820:Disp1 UTSW 1 182,917,151 (GRCm39) missense probably benign 0.00
R6184:Disp1 UTSW 1 182,867,896 (GRCm39) missense probably benign 0.00
R6228:Disp1 UTSW 1 182,880,589 (GRCm39) missense possibly damaging 0.59
R6306:Disp1 UTSW 1 182,868,712 (GRCm39) missense possibly damaging 0.93
R6505:Disp1 UTSW 1 182,868,076 (GRCm39) missense probably benign 0.02
R6925:Disp1 UTSW 1 182,868,042 (GRCm39) missense probably benign
R7016:Disp1 UTSW 1 182,869,030 (GRCm39) missense probably damaging 1.00
R7045:Disp1 UTSW 1 182,869,030 (GRCm39) missense probably damaging 1.00
R7046:Disp1 UTSW 1 182,869,030 (GRCm39) missense probably damaging 1.00
R7047:Disp1 UTSW 1 182,869,030 (GRCm39) missense probably damaging 1.00
R7114:Disp1 UTSW 1 182,869,030 (GRCm39) missense probably damaging 1.00
R7123:Disp1 UTSW 1 182,869,030 (GRCm39) missense probably damaging 1.00
R7124:Disp1 UTSW 1 182,869,030 (GRCm39) missense probably damaging 1.00
R7125:Disp1 UTSW 1 182,869,030 (GRCm39) missense probably damaging 1.00
R7161:Disp1 UTSW 1 182,869,189 (GRCm39) missense possibly damaging 0.84
R7510:Disp1 UTSW 1 182,869,975 (GRCm39) missense probably damaging 1.00
R7756:Disp1 UTSW 1 182,871,298 (GRCm39) missense probably damaging 1.00
R7800:Disp1 UTSW 1 182,880,550 (GRCm39) missense probably benign 0.00
R7929:Disp1 UTSW 1 182,917,103 (GRCm39) missense probably benign
R8029:Disp1 UTSW 1 182,870,852 (GRCm39) missense probably damaging 1.00
R8036:Disp1 UTSW 1 182,870,803 (GRCm39) missense probably damaging 1.00
R8045:Disp1 UTSW 1 182,870,794 (GRCm39) missense probably damaging 1.00
R8054:Disp1 UTSW 1 182,869,812 (GRCm39) nonsense probably null
R8061:Disp1 UTSW 1 182,869,151 (GRCm39) missense probably damaging 1.00
R8094:Disp1 UTSW 1 182,869,192 (GRCm39) missense probably damaging 1.00
R8130:Disp1 UTSW 1 182,917,199 (GRCm39) missense probably benign 0.13
R8731:Disp1 UTSW 1 182,869,072 (GRCm39) missense possibly damaging 0.65
R9076:Disp1 UTSW 1 182,868,799 (GRCm39) missense possibly damaging 0.59
R9490:Disp1 UTSW 1 182,871,092 (GRCm39) missense probably benign 0.03
R9712:Disp1 UTSW 1 182,917,379 (GRCm39) missense probably damaging 0.99
R9745:Disp1 UTSW 1 182,869,310 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCTTCAATTTGAGCAGCACCC -3'
(R):5'- GCCACCCAGTTGTCACTGAAATGTC -3'

Sequencing Primer
(F):5'- TGAGCAGCACCCTTCCC -3'
(R):5'- GTCACTGAAATGTCTTGCTAGACTG -3'
Posted On 2014-01-05