Incidental Mutation 'R1034:Eftud2'
ID 95450
Institutional Source Beutler Lab
Gene Symbol Eftud2
Ensembl Gene ENSMUSG00000020929
Gene Name elongation factor Tu GTP binding domain containing 2
Synonyms 116kDa, Snrp116, U5-116kD
MMRRC Submission 039133-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1034 (G1)
Quality Score 188
Status Not validated
Chromosome 11
Chromosomal Location 102838473-102880985 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 102849184 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 461 (D461E)
Ref Sequence ENSEMBL: ENSMUSP00000134327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021306] [ENSMUST00000107060] [ENSMUST00000173679]
AlphaFold O08810
Predicted Effect probably benign
Transcript: ENSMUST00000021306
AA Change: D471E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021306
Gene: ENSMUSG00000020929
AA Change: D471E

DomainStartEndE-ValueType
Pfam:EFTUD2 3 110 1.1e-42 PFAM
Pfam:GTP_EFTU 127 440 9.6e-47 PFAM
Pfam:GTP_EFTU_D2 489 566 3.8e-15 PFAM
Pfam:EFG_II 584 656 9.9e-11 PFAM
EFG_IV 703 824 1.1e-16 SMART
EFG_C 826 915 1.14e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107060
AA Change: D470E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102675
Gene: ENSMUSG00000020929
AA Change: D470E

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
low complexity region 32 50 N/A INTRINSIC
Pfam:GTP_EFTU 126 439 9.6e-44 PFAM
Pfam:Miro 130 260 2.5e-6 PFAM
Pfam:GTP_EFTU_D2 488 565 7.9e-13 PFAM
Pfam:EFG_II 583 655 8.2e-10 PFAM
EFG_IV 702 823 1.1e-16 SMART
EFG_C 825 914 1.14e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141273
Predicted Effect probably benign
Transcript: ENSMUST00000172611
SMART Domains Protein: ENSMUSP00000134316
Gene: ENSMUSG00000020929

DomainStartEndE-ValueType
low complexity region 85 98 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173679
AA Change: D461E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134327
Gene: ENSMUSG00000020929
AA Change: D461E

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
low complexity region 29 51 N/A INTRINSIC
Pfam:GTP_EFTU 127 430 2.2e-36 PFAM
Pfam:GTP_EFTU_D2 479 556 7.8e-13 PFAM
Pfam:EFG_II 574 646 8.1e-10 PFAM
EFG_IV 693 814 1.1e-16 SMART
EFG_C 816 905 1.14e-14 SMART
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.3%
  • 10x: 92.9%
  • 20x: 82.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase which is a component of the spliceosome complex which processes precursor mRNAs to produce mature mRNAs. Mutations in this gene are associated with mandibulofacial dysostosis with microcephaly. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Abca14 T C 7: 120,216,147 F206S probably damaging Het
Arid2 T C 15: 96,369,505 V622A probably benign Het
Asic1 T A 15: 99,698,058 L437Q probably damaging Het
Atp1b1 C T 1: 164,453,488 probably null Het
B3gnt5 A G 16: 19,769,484 Y151C probably damaging Het
Cbx4 A G 11: 119,081,707 S281P probably damaging Het
Dnah5 G A 15: 28,302,471 V1625I probably damaging Het
Epgn A G 5: 91,032,221 Y74C probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fgf14 C T 14: 124,132,534 V113I probably damaging Het
Ggcx G A 6: 72,414,831 R68H probably damaging Het
Gm1110 A G 9: 26,921,350 S16P probably damaging Het
Gm6729 T C 10: 86,540,026 noncoding transcript Het
Gpr108 A G 17: 57,235,995 F522S probably damaging Het
Gpr156 T C 16: 38,004,726 V435A probably benign Het
Khdrbs2 T C 1: 32,467,791 L172P probably damaging Het
Kmo C T 1: 175,651,618 P240L possibly damaging Het
Ltn1 A T 16: 87,397,137 probably null Het
Nbeal1 T A 1: 60,290,006 Y2194* probably null Het
Olfr767 T A 10: 129,079,961 M1L probably benign Het
Olfr867 A T 9: 20,055,365 S33T probably benign Het
Rab6b T C 9: 103,167,124 S172P probably benign Het
Ror1 T A 4: 100,333,620 L58* probably null Het
Sec23b A G 2: 144,590,338 D756G possibly damaging Het
Slc24a2 T A 4: 87,032,275 K428N probably damaging Het
Spen C A 4: 141,475,752 V1855L probably benign Het
Srgap1 G A 10: 121,785,445 P1071S possibly damaging Het
Tns1 A G 1: 73,941,969 C1079R probably damaging Het
Traf3ip1 G T 1: 91,518,319 probably null Het
Trmt2a T C 16: 18,249,709 F82S probably damaging Het
Xrn1 A G 9: 96,039,737 D1401G probably damaging Het
Zfp352 T A 4: 90,224,156 S178T possibly damaging Het
Zfp758 G T 17: 22,375,759 E409* probably null Het
Other mutations in Eftud2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Eftud2 APN 11 102865563 splice site probably benign
IGL01765:Eftud2 APN 11 102839256 missense probably damaging 0.99
IGL01868:Eftud2 APN 11 102869127 missense probably benign 0.08
IGL02161:Eftud2 APN 11 102854876 splice site probably benign
IGL02165:Eftud2 APN 11 102851747 splice site probably benign
IGL02218:Eftud2 APN 11 102870213 missense possibly damaging 0.46
IGL02386:Eftud2 APN 11 102851754 splice site probably null
IGL02664:Eftud2 APN 11 102841712 missense probably damaging 1.00
IGL02677:Eftud2 APN 11 102846614 missense probably damaging 1.00
IGL02792:Eftud2 APN 11 102870256 splice site probably benign
IGL02870:Eftud2 APN 11 102862626 missense probably damaging 0.97
IGL03131:Eftud2 APN 11 102870183 missense probably damaging 1.00
R0137:Eftud2 UTSW 11 102868617 missense possibly damaging 0.94
R0244:Eftud2 UTSW 11 102864725 missense probably damaging 0.97
R0358:Eftud2 UTSW 11 102864801 splice site probably benign
R0463:Eftud2 UTSW 11 102864771 missense probably damaging 1.00
R0511:Eftud2 UTSW 11 102844222 missense probably damaging 1.00
R0525:Eftud2 UTSW 11 102839253 missense probably damaging 1.00
R0586:Eftud2 UTSW 11 102846620 missense probably damaging 1.00
R0751:Eftud2 UTSW 11 102839253 missense probably damaging 1.00
R1079:Eftud2 UTSW 11 102840044 nonsense probably null
R1208:Eftud2 UTSW 11 102864766 missense probably benign 0.22
R1208:Eftud2 UTSW 11 102864766 missense probably benign 0.22
R1220:Eftud2 UTSW 11 102851747 splice site probably benign
R1438:Eftud2 UTSW 11 102860042 missense probably damaging 1.00
R1520:Eftud2 UTSW 11 102839440 missense probably damaging 1.00
R1569:Eftud2 UTSW 11 102854771 splice site probably benign
R2270:Eftud2 UTSW 11 102864781 missense probably damaging 1.00
R3500:Eftud2 UTSW 11 102844180 missense probably damaging 1.00
R3686:Eftud2 UTSW 11 102844201 missense probably damaging 1.00
R3687:Eftud2 UTSW 11 102844201 missense probably damaging 1.00
R3688:Eftud2 UTSW 11 102844201 missense probably damaging 1.00
R3808:Eftud2 UTSW 11 102841463 splice site probably null
R3892:Eftud2 UTSW 11 102846187 missense probably damaging 0.99
R4003:Eftud2 UTSW 11 102860110 missense possibly damaging 0.51
R4091:Eftud2 UTSW 11 102839416 splice site probably null
R4794:Eftud2 UTSW 11 102870177 missense probably benign 0.14
R4841:Eftud2 UTSW 11 102854814 missense probably damaging 1.00
R4842:Eftud2 UTSW 11 102854814 missense probably damaging 1.00
R5151:Eftud2 UTSW 11 102867844 critical splice donor site probably null
R5208:Eftud2 UTSW 11 102841185 missense probably damaging 1.00
R6199:Eftud2 UTSW 11 102840057 missense probably damaging 1.00
R6357:Eftud2 UTSW 11 102864780 missense probably damaging 1.00
R6720:Eftud2 UTSW 11 102838623 nonsense probably null
R7604:Eftud2 UTSW 11 102848012 missense possibly damaging 0.87
R7886:Eftud2 UTSW 11 102840108 missense probably damaging 1.00
R8017:Eftud2 UTSW 11 102843348 critical splice donor site probably null
R8019:Eftud2 UTSW 11 102843348 critical splice donor site probably null
R8139:Eftud2 UTSW 11 102867859 missense probably benign 0.04
R8431:Eftud2 UTSW 11 102846236 missense probably benign 0.08
R8545:Eftud2 UTSW 11 102840271 missense probably damaging 1.00
R8676:Eftud2 UTSW 11 102868621 missense probably damaging 1.00
R9089:Eftud2 UTSW 11 102869145 missense probably benign
R9173:Eftud2 UTSW 11 102843416 missense probably damaging 1.00
R9277:Eftud2 UTSW 11 102860029 missense probably damaging 1.00
R9313:Eftud2 UTSW 11 102839436 missense probably benign 0.03
R9604:Eftud2 UTSW 11 102846230 missense probably benign 0.11
R9664:Eftud2 UTSW 11 102868596 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCTTAGGTCACAGACTCGGACAG -3'
(R):5'- GGAATTGTGTCCCACTAAGACCTGC -3'

Sequencing Primer
(F):5'- AGACTCGGACAGCCACG -3'
(R):5'- ccagggctacacagagaaac -3'
Posted On 2014-01-05