Incidental Mutation 'R1120:Olfr1214'
ID95453
Institutional Source Beutler Lab
Gene Symbol Olfr1214
Ensembl Gene ENSMUSG00000075110
Gene Nameolfactory receptor 1214
SynonymsGA_x6K02T2Q125-50468705-50467770, MOR233-8
MMRRC Submission 039193-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R1120 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location88986479-88992653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88988079 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 41 (M41T)
Ref Sequence ENSEMBL: ENSMUSP00000150322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099804] [ENSMUST00000216026] [ENSMUST00000217469]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099804
AA Change: M41T

PolyPhen 2 Score 0.506 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097392
Gene: ENSMUSG00000075110
AA Change: M41T

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.1e-45 PFAM
Pfam:7tm_1 39 286 4.1e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216026
AA Change: M41T

PolyPhen 2 Score 0.506 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217469
AA Change: M41T

PolyPhen 2 Score 0.506 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.2349 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T G 5: 24,408,820 probably null Het
Akp3 A T 1: 87,125,437 Q77L probably damaging Het
Blm A G 7: 80,481,466 L878S probably damaging Het
Cabin1 A G 10: 75,725,716 Y984H probably damaging Het
Cadps2 T C 6: 23,838,794 Q86R probably damaging Het
Cd2 C T 3: 101,287,488 D95N probably damaging Het
Cd36 A G 5: 17,785,828 I438T possibly damaging Het
Crhbp G T 13: 95,442,085 T176K probably benign Het
D630045J12Rik G T 6: 38,194,770 T821K probably damaging Het
Disp1 T C 1: 183,098,575 D288G probably benign Het
Dsc3 A G 18: 19,986,977 V208A probably benign Het
Eef1e1 A T 13: 38,658,934 N20K probably damaging Het
Ercc5 A G 1: 44,161,841 D187G probably damaging Het
Etl4 T A 2: 20,806,703 M1199K probably benign Het
Fnbp1 A T 2: 31,036,594 Y433N probably damaging Het
Fxyd3 A G 7: 31,071,378 probably benign Het
Hfm1 A T 5: 106,904,218 probably benign Het
Irak2 T A 6: 113,675,759 probably benign Het
Jpt2 T C 17: 24,960,611 M1V probably null Het
Knl1 A G 2: 119,062,375 R51G probably damaging Het
Krtap8-1 A G 16: 89,487,865 Y15H probably benign Het
Lrba A T 3: 86,295,192 D250V probably damaging Het
Mgat4a A G 1: 37,452,581 S357P probably damaging Het
Nup98 T A 7: 102,160,716 T536S probably damaging Het
Olfr1197 A G 2: 88,728,937 Y221H probably damaging Het
Olfr825 A G 10: 130,162,537 L263P probably damaging Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pnpla8 A G 12: 44,304,947 T568A possibly damaging Het
Ptprn A G 1: 75,258,181 I254T probably benign Het
Rab5b A C 10: 128,679,614 N188K probably benign Het
Samd5 A G 10: 9,629,048 V154A possibly damaging Het
Smarcb1 A G 10: 75,921,323 F25L probably benign Het
Smchd1 A T 17: 71,358,146 Y1847* probably null Het
Smpd4 T C 16: 17,638,486 probably benign Het
Tex14 T A 11: 87,538,676 probably benign Het
Tnfrsf26 G A 7: 143,617,914 R101C probably damaging Het
Trmu A G 15: 85,890,285 K37E possibly damaging Het
Tsen54 C T 11: 115,815,013 A52V probably damaging Het
Ubb T C 11: 62,552,183 I13T possibly damaging Het
Vmn2r101 A T 17: 19,577,461 probably benign Het
Other mutations in Olfr1214
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02650:Olfr1214 APN 2 88988080 missense probably benign 0.00
IGL03409:Olfr1214 APN 2 88987587 missense possibly damaging 0.93
R0046:Olfr1214 UTSW 2 88987349 missense probably benign 0.00
R0046:Olfr1214 UTSW 2 88987349 missense probably benign 0.00
R0503:Olfr1214 UTSW 2 88987978 missense probably benign 0.01
R0688:Olfr1214 UTSW 2 88987595 missense probably damaging 1.00
R1752:Olfr1214 UTSW 2 88987315 missense possibly damaging 0.60
R2018:Olfr1214 UTSW 2 88988145 missense probably benign 0.06
R2281:Olfr1214 UTSW 2 88987470 missense probably benign 0.03
R2509:Olfr1214 UTSW 2 88987431 missense probably damaging 1.00
R2862:Olfr1214 UTSW 2 88987320 missense probably benign
R3942:Olfr1214 UTSW 2 88988111 missense probably benign 0.15
R4894:Olfr1214 UTSW 2 88987439 missense possibly damaging 0.83
R4899:Olfr1214 UTSW 2 88988110 missense probably null 0.13
R5089:Olfr1214 UTSW 2 88988172 missense probably damaging 1.00
R5253:Olfr1214 UTSW 2 88988100 missense possibly damaging 0.67
R5338:Olfr1214 UTSW 2 88987465 missense possibly damaging 0.87
R6476:Olfr1214 UTSW 2 88987377 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGCACAGCAAAGACCTGTGTCATAC -3'
(R):5'- TCAGCCCTGCCTAGTTCCATGAAG -3'

Sequencing Primer
(F):5'- GACCTGTGTCATACAACATTCAAAAG -3'
(R):5'- ATTCAGGTATGGCTTCTAATGTCTTC -3'
Posted On2014-01-05