Incidental Mutation 'R1034:Cbx4'
ID 95454
Institutional Source Beutler Lab
Gene Symbol Cbx4
Ensembl Gene ENSMUSG00000039989
Gene Name chromobox 4
Synonyms PC2, MPc2
MMRRC Submission 039133-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1034 (G1)
Quality Score 134
Status Not validated
Chromosome 11
Chromosomal Location 119077573-119086221 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 119081707 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 281 (S281P)
Ref Sequence ENSEMBL: ENSMUSP00000026665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026665]
AlphaFold O55187
Predicted Effect probably damaging
Transcript: ENSMUST00000026665
AA Change: S281P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026665
Gene: ENSMUSG00000039989
AA Change: S281P

DomainStartEndE-ValueType
CHROMO 10 62 5.23e-20 SMART
low complexity region 138 152 N/A INTRINSIC
low complexity region 209 230 N/A INTRINSIC
low complexity region 311 323 N/A INTRINSIC
low complexity region 488 520 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145058
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181285
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.3%
  • 10x: 92.9%
  • 20x: 82.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene results in complete neonatal lethality and severe thymus hypoplasia as a result of reduced thymocyte proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Abca14 T C 7: 120,216,147 F206S probably damaging Het
Arid2 T C 15: 96,369,505 V622A probably benign Het
Asic1 T A 15: 99,698,058 L437Q probably damaging Het
Atp1b1 C T 1: 164,453,488 probably null Het
B3gnt5 A G 16: 19,769,484 Y151C probably damaging Het
Dnah5 G A 15: 28,302,471 V1625I probably damaging Het
Eftud2 A C 11: 102,849,184 D461E probably benign Het
Epgn A G 5: 91,032,221 Y74C probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fgf14 C T 14: 124,132,534 V113I probably damaging Het
Ggcx G A 6: 72,414,831 R68H probably damaging Het
Gm1110 A G 9: 26,921,350 S16P probably damaging Het
Gm6729 T C 10: 86,540,026 noncoding transcript Het
Gpr108 A G 17: 57,235,995 F522S probably damaging Het
Gpr156 T C 16: 38,004,726 V435A probably benign Het
Khdrbs2 T C 1: 32,467,791 L172P probably damaging Het
Kmo C T 1: 175,651,618 P240L possibly damaging Het
Ltn1 A T 16: 87,397,137 probably null Het
Nbeal1 T A 1: 60,290,006 Y2194* probably null Het
Olfr767 T A 10: 129,079,961 M1L probably benign Het
Olfr867 A T 9: 20,055,365 S33T probably benign Het
Rab6b T C 9: 103,167,124 S172P probably benign Het
Ror1 T A 4: 100,333,620 L58* probably null Het
Sec23b A G 2: 144,590,338 D756G possibly damaging Het
Slc24a2 T A 4: 87,032,275 K428N probably damaging Het
Spen C A 4: 141,475,752 V1855L probably benign Het
Srgap1 G A 10: 121,785,445 P1071S possibly damaging Het
Tns1 A G 1: 73,941,969 C1079R probably damaging Het
Traf3ip1 G T 1: 91,518,319 probably null Het
Trmt2a T C 16: 18,249,709 F82S probably damaging Het
Xrn1 A G 9: 96,039,737 D1401G probably damaging Het
Zfp352 T A 4: 90,224,156 S178T possibly damaging Het
Zfp758 G T 17: 22,375,759 E409* probably null Het
Other mutations in Cbx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02456:Cbx4 APN 11 119082112 nonsense probably null
R2113:Cbx4 UTSW 11 119081892 missense probably damaging 1.00
R4995:Cbx4 UTSW 11 119081211 missense probably benign 0.01
R5226:Cbx4 UTSW 11 119081928 missense probably damaging 0.99
R5893:Cbx4 UTSW 11 119082190 missense probably damaging 1.00
R6398:Cbx4 UTSW 11 119081082 missense probably damaging 1.00
R7140:Cbx4 UTSW 11 119081928 missense probably damaging 0.99
R7811:Cbx4 UTSW 11 119081572 missense probably benign 0.00
X0064:Cbx4 UTSW 11 119084593 missense probably damaging 1.00
Z1177:Cbx4 UTSW 11 119085766 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCATCTTGACACAGCGCAAGTC -3'
(R):5'- TGGCATGACACCAGCCCCTAAG -3'

Sequencing Primer
(F):5'- ggtggtggtggtgatgg -3'
(R):5'- CCCCTAAGGAGGCAGTGAC -3'
Posted On 2014-01-05