Mutagenetix > Incidental Mutation

Incidental Mutation 'R1034:Cbx4'

95454

Institutional Source

Beutler Lab

Gene Symbol

Cbx4

Ensembl Gene

ENSMUSG00000039989

Gene Name

chromobox 4

Synonyms

PC2, MPc2

MMRRC Submission

039133-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1034 (G1)

Quality Score

134

Status

Not validated

Chromosome

Chromosomal Location

119077573-119086221 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 119081707 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 281 (S281P)

Ref Sequence

ENSEMBL: ENSMUSP00000026665 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026665]

AlphaFold

O55187

Predicted Effect

probably damaging
Transcript: ENSMUST00000026665
AA Change: S281P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000026665
Gene: ENSMUSG00000039989
AA Change: S281P

Domain	Start	End	E-Value	Type
CHROMO	10	62	5.23e-20	SMART
low complexity region	138	152	N/A	INTRINSIC
low complexity region	209	230	N/A	INTRINSIC
low complexity region	311	323	N/A	INTRINSIC
low complexity region	488	520	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145058

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181285

Coding Region Coverage

1x: 98.7%
3x: 97.3%
10x: 92.9%
20x: 82.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous inactivation of this gene results in complete neonatal lethality and severe thymus hypoplasia as a result of reduced thymocyte proliferation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	G	A	5: 76,876,283	T174M	probably damaging	Het
Abca14	T	C	7: 120,216,147	F206S	probably damaging	Het
Arid2	T	C	15: 96,369,505	V622A	probably benign	Het
Asic1	T	A	15: 99,698,058	L437Q	probably damaging	Het
Atp1b1	C	T	1: 164,453,488		probably null	Het
B3gnt5	A	G	16: 19,769,484	Y151C	probably damaging	Het
Dnah5	G	A	15: 28,302,471	V1625I	probably damaging	Het
Eftud2	A	C	11: 102,849,184	D461E	probably benign	Het
Epgn	A	G	5: 91,032,221	Y74C	probably damaging	Het
Fcho1	C	T	8: 71,712,560	A418T	probably benign	Het
Fgf14	C	T	14: 124,132,534	V113I	probably damaging	Het
Ggcx	G	A	6: 72,414,831	R68H	probably damaging	Het
Gm1110	A	G	9: 26,921,350	S16P	probably damaging	Het
Gm6729	T	C	10: 86,540,026		noncoding transcript	Het
Gpr108	A	G	17: 57,235,995	F522S	probably damaging	Het
Gpr156	T	C	16: 38,004,726	V435A	probably benign	Het
Khdrbs2	T	C	1: 32,467,791	L172P	probably damaging	Het
Kmo	C	T	1: 175,651,618	P240L	possibly damaging	Het
Ltn1	A	T	16: 87,397,137		probably null	Het
Nbeal1	T	A	1: 60,290,006	Y2194*	probably null	Het
Olfr767	T	A	10: 129,079,961	M1L	probably benign	Het
Olfr867	A	T	9: 20,055,365	S33T	probably benign	Het
Rab6b	T	C	9: 103,167,124	S172P	probably benign	Het
Ror1	T	A	4: 100,333,620	L58*	probably null	Het
Sec23b	A	G	2: 144,590,338	D756G	possibly damaging	Het
Slc24a2	T	A	4: 87,032,275	K428N	probably damaging	Het
Spen	C	A	4: 141,475,752	V1855L	probably benign	Het
Srgap1	G	A	10: 121,785,445	P1071S	possibly damaging	Het
Tns1	A	G	1: 73,941,969	C1079R	probably damaging	Het
Traf3ip1	G	T	1: 91,518,319		probably null	Het
Trmt2a	T	C	16: 18,249,709	F82S	probably damaging	Het
Xrn1	A	G	9: 96,039,737	D1401G	probably damaging	Het
Zfp352	T	A	4: 90,224,156	S178T	possibly damaging	Het
Zfp758	G	T	17: 22,375,759	E409*	probably null	Het

Other mutations in Cbx4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02456:Cbx4	APN	11	119082112	nonsense	probably null
R2113:Cbx4	UTSW	11	119081892	missense	probably damaging	1.00
R4995:Cbx4	UTSW	11	119081211	missense	probably benign	0.01
R5226:Cbx4	UTSW	11	119081928	missense	probably damaging	0.99
R5893:Cbx4	UTSW	11	119082190	missense	probably damaging	1.00
R6398:Cbx4	UTSW	11	119081082	missense	probably damaging	1.00
R7140:Cbx4	UTSW	11	119081928	missense	probably damaging	0.99
R7811:Cbx4	UTSW	11	119081572	missense	probably benign	0.00
X0064:Cbx4	UTSW	11	119084593	missense	probably damaging	1.00
Z1177:Cbx4	UTSW	11	119085766	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GCATCTTGACACAGCGCAAGTC -3'
(R):5'- TGGCATGACACCAGCCCCTAAG -3'

Sequencing Primer
(F):5'- ggtggtggtggtgatgg -3'
(R):5'- CCCCTAAGGAGGCAGTGAC -3'

Posted On

2014-01-05