Incidental Mutation 'R1034:Fgf14'
ID95462
Institutional Source Beutler Lab
Gene Symbol Fgf14
Ensembl Gene ENSMUSG00000025551
Gene Namefibroblast growth factor 14
SynonymsFhf4
MMRRC Submission 039133-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R1034 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location123977907-124677127 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 124132534 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 113 (V113I)
Ref Sequence ENSEMBL: ENSMUSP00000026631 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026631] [ENSMUST00000095529]
Predicted Effect probably damaging
Transcript: ENSMUST00000026631
AA Change: V113I

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000026631
Gene: ENSMUSG00000025551
AA Change: V113I

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
FGF 69 200 1.75e-63 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095529
AA Change: V118I

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000093185
Gene: ENSMUSG00000025551
AA Change: V118I

DomainStartEndE-ValueType
FGF 74 205 1.75e-63 SMART
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.3%
  • 10x: 92.9%
  • 20x: 82.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. A mutation in this gene is associated with autosomal dominant cerebral ataxia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display impaired balance and grip strength. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Abca14 T C 7: 120,216,147 F206S probably damaging Het
Arid2 T C 15: 96,369,505 V622A probably benign Het
Asic1 T A 15: 99,698,058 L437Q probably damaging Het
Atp1b1 C T 1: 164,453,488 probably null Het
B3gnt5 A G 16: 19,769,484 Y151C probably damaging Het
Cbx4 A G 11: 119,081,707 S281P probably damaging Het
Dnah5 G A 15: 28,302,471 V1625I probably damaging Het
Eftud2 A C 11: 102,849,184 D461E probably benign Het
Epgn A G 5: 91,032,221 Y74C probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Ggcx G A 6: 72,414,831 R68H probably damaging Het
Gm1110 A G 9: 26,921,350 S16P probably damaging Het
Gm6729 T C 10: 86,540,026 noncoding transcript Het
Gpr108 A G 17: 57,235,995 F522S probably damaging Het
Gpr156 T C 16: 38,004,726 V435A probably benign Het
Khdrbs2 T C 1: 32,467,791 L172P probably damaging Het
Kmo C T 1: 175,651,618 P240L possibly damaging Het
Ltn1 A T 16: 87,397,137 probably null Het
Nbeal1 T A 1: 60,290,006 Y2194* probably null Het
Olfr767 T A 10: 129,079,961 M1L probably benign Het
Olfr867 A T 9: 20,055,365 S33T probably benign Het
Rab6b T C 9: 103,167,124 S172P probably benign Het
Ror1 T A 4: 100,333,620 L58* probably null Het
Sec23b A G 2: 144,590,338 D756G possibly damaging Het
Slc24a2 T A 4: 87,032,275 K428N probably damaging Het
Spen C A 4: 141,475,752 V1855L probably benign Het
Srgap1 G A 10: 121,785,445 P1071S possibly damaging Het
Tns1 A G 1: 73,941,969 C1079R probably damaging Het
Traf3ip1 G T 1: 91,518,319 probably null Het
Trmt2a T C 16: 18,249,709 F82S probably damaging Het
Xrn1 A G 9: 96,039,737 D1401G probably damaging Het
Zfp352 T A 4: 90,224,156 S178T possibly damaging Het
Zfp758 G T 17: 22,375,759 E409* probably null Het
Other mutations in Fgf14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02136:Fgf14 APN 14 123980372 missense possibly damaging 0.51
IGL02733:Fgf14 APN 14 123983801 missense probably damaging 1.00
IGL02939:Fgf14 APN 14 124132479 missense possibly damaging 0.82
R0517:Fgf14 UTSW 14 123983784 missense probably damaging 1.00
R0608:Fgf14 UTSW 14 124676603 missense probably damaging 0.99
R1183:Fgf14 UTSW 14 124676524 missense probably benign 0.03
R1466:Fgf14 UTSW 14 124676539 missense probably benign 0.19
R1466:Fgf14 UTSW 14 124676539 missense probably benign 0.19
R1584:Fgf14 UTSW 14 124676539 missense probably benign 0.19
R1768:Fgf14 UTSW 14 124676512 missense probably benign 0.00
R2190:Fgf14 UTSW 14 123983918 missense probably damaging 1.00
R2307:Fgf14 UTSW 14 123983822 missense probably damaging 1.00
R3743:Fgf14 UTSW 14 124676620 missense probably benign
R3847:Fgf14 UTSW 14 123980389 missense probably benign 0.05
R4859:Fgf14 UTSW 14 124192433 missense possibly damaging 0.78
R5529:Fgf14 UTSW 14 123980455 missense probably damaging 1.00
R5655:Fgf14 UTSW 14 124192416 missense probably benign
R6242:Fgf14 UTSW 14 124676528 missense probably benign 0.02
R6958:Fgf14 UTSW 14 124676597 missense probably benign
R7460:Fgf14 UTSW 14 124676693 missense possibly damaging 0.92
R7726:Fgf14 UTSW 14 124136244 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACATCATTAGCTTCTGCTGCTGC -3'
(R):5'- GCCCCTCAAACCCTTCAAAATGTTG -3'

Sequencing Primer
(F):5'- GCTCTAGCTATTTTACCAATACTGTG -3'
(R):5'- CCCTTCAAAATGTTGTGAGCAAG -3'
Posted On2014-01-05