Incidental Mutation 'R1034:Trmt2a'
ID 95474
Institutional Source Beutler Lab
Gene Symbol Trmt2a
Ensembl Gene ENSMUSG00000022721
Gene Name TRM2 tRNA methyltransferase 2A
Synonyms Htf9c
MMRRC Submission 039133-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1034 (G1)
Quality Score 187
Status Not validated
Chromosome 16
Chromosomal Location 18248679-18254772 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 18249709 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 82 (F82S)
Ref Sequence ENSEMBL: ENSMUSP00000111303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009321] [ENSMUST00000052325] [ENSMUST00000100099] [ENSMUST00000115640] [ENSMUST00000115645] [ENSMUST00000128045] [ENSMUST00000140206] [ENSMUST00000231509]
AlphaFold Q8BNV1
Predicted Effect probably benign
Transcript: ENSMUST00000009321
SMART Domains Protein: ENSMUSP00000009321
Gene: ENSMUSG00000022718

DomainStartEndE-ValueType
low complexity region 165 176 N/A INTRINSIC
WW 302 334 7.26e-6 SMART
low complexity region 411 421 N/A INTRINSIC
DSRM 512 577 5.68e-10 SMART
DSRM 620 685 8.26e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052325
SMART Domains Protein: ENSMUSP00000055288
Gene: ENSMUSG00000005732

DomainStartEndE-ValueType
RanBD 1 108 4.92e-46 SMART
coiled coil region 123 153 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000059696
Predicted Effect probably damaging
Transcript: ENSMUST00000100099
AA Change: F82S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111303
Gene: ENSMUSG00000022721
AA Change: F82S

DomainStartEndE-ValueType
low complexity region 35 44 N/A INTRINSIC
RRM 64 132 1.37e-2 SMART
coiled coil region 171 195 N/A INTRINSIC
Pfam:tRNA_U5-meth_tr 380 579 1.2e-20 PFAM
Pfam:PCMT 386 482 1.1e-8 PFAM
Pfam:MTS 389 489 6.2e-9 PFAM
Pfam:Methyltransf_4 397 497 4.2e-7 PFAM
Pfam:Methyltransf_31 420 546 6.2e-15 PFAM
Pfam:Methyltransf_18 422 523 9.3e-11 PFAM
Pfam:Methyltransf_26 423 538 5.3e-12 PFAM
Pfam:Methyltransf_25 426 511 3.5e-8 PFAM
Pfam:Methyltransf_11 427 487 5.6e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115640
AA Change: F82S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000111304
Gene: ENSMUSG00000022721
AA Change: F82S

DomainStartEndE-ValueType
low complexity region 35 44 N/A INTRINSIC
RRM 64 132 1.37e-2 SMART
coiled coil region 171 195 N/A INTRINSIC
Pfam:tRNA_U5-meth_tr 380 579 2.6e-20 PFAM
Pfam:PCMT 386 482 3.4e-9 PFAM
Pfam:MTS 392 489 1e-7 PFAM
Pfam:Cons_hypoth95 405 542 2.7e-7 PFAM
Pfam:Methyltransf_31 420 547 2.1e-15 PFAM
Pfam:Methyltransf_18 422 526 2.9e-12 PFAM
Pfam:Methyltransf_4 423 499 2.6e-7 PFAM
Pfam:Methyltransf_25 426 511 1.3e-8 PFAM
Pfam:Methyltransf_11 427 489 3.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115645
SMART Domains Protein: ENSMUSP00000111309
Gene: ENSMUSG00000005732

DomainStartEndE-ValueType
RanBD 27 158 3.33e-75 SMART
low complexity region 183 202 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123073
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127239
Predicted Effect probably benign
Transcript: ENSMUST00000128045
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131211
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134035
Predicted Effect probably damaging
Transcript: ENSMUST00000140206
AA Change: F82S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121216
Gene: ENSMUSG00000022721
AA Change: F82S

DomainStartEndE-ValueType
low complexity region 35 44 N/A INTRINSIC
RRM 64 132 1.37e-2 SMART
coiled coil region 171 195 N/A INTRINSIC
Pfam:tRNA_U5-meth_tr 383 481 3.7e-8 PFAM
Pfam:PCMT 386 481 1.5e-6 PFAM
Pfam:MTS 389 493 2.5e-7 PFAM
Pfam:Methyltransf_31 420 491 1.5e-9 PFAM
Pfam:Methyltransf_18 422 508 4.1e-8 PFAM
Pfam:Methyltransf_26 423 523 3.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153292
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147273
Predicted Effect probably benign
Transcript: ENSMUST00000232144
Predicted Effect probably benign
Transcript: ENSMUST00000231509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232015
Predicted Effect probably benign
Transcript: ENSMUST00000145112
SMART Domains Protein: ENSMUSP00000117026
Gene: ENSMUSG00000022721

DomainStartEndE-ValueType
Pfam:PCMT 118 220 4.2e-7 PFAM
Pfam:tRNA_U5-meth_tr 118 280 4e-16 PFAM
Pfam:MTS 129 229 5.4e-6 PFAM
Pfam:Cons_hypoth95 143 277 6.5e-5 PFAM
Pfam:PrmA 146 234 2e-4 PFAM
Pfam:Ubie_methyltran 148 223 1e-4 PFAM
Pfam:Methyltransf_31 158 271 6.1e-14 PFAM
Pfam:Methyltransf_18 160 263 8.3e-11 PFAM
Pfam:Methyltransf_4 161 237 7.1e-5 PFAM
Pfam:Methyltransf_26 161 274 2e-6 PFAM
Pfam:Methyltransf_25 164 251 5.2e-7 PFAM
Pfam:Methyltransf_11 165 227 9.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000232293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232342
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.3%
  • 10x: 92.9%
  • 20x: 82.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is of unknown function. However, it is orthologous to the mouse Trmt2a gene and contains an RNA methyltransferase domain. Expression of this gene varies during the cell cycle, with aberrant expression being a possible biomarker in certain breast cancers. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Abca14 T C 7: 120,216,147 F206S probably damaging Het
Arid2 T C 15: 96,369,505 V622A probably benign Het
Asic1 T A 15: 99,698,058 L437Q probably damaging Het
Atp1b1 C T 1: 164,453,488 probably null Het
B3gnt5 A G 16: 19,769,484 Y151C probably damaging Het
Cbx4 A G 11: 119,081,707 S281P probably damaging Het
Dnah5 G A 15: 28,302,471 V1625I probably damaging Het
Eftud2 A C 11: 102,849,184 D461E probably benign Het
Epgn A G 5: 91,032,221 Y74C probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fgf14 C T 14: 124,132,534 V113I probably damaging Het
Ggcx G A 6: 72,414,831 R68H probably damaging Het
Gm1110 A G 9: 26,921,350 S16P probably damaging Het
Gm6729 T C 10: 86,540,026 noncoding transcript Het
Gpr108 A G 17: 57,235,995 F522S probably damaging Het
Gpr156 T C 16: 38,004,726 V435A probably benign Het
Khdrbs2 T C 1: 32,467,791 L172P probably damaging Het
Kmo C T 1: 175,651,618 P240L possibly damaging Het
Ltn1 A T 16: 87,397,137 probably null Het
Nbeal1 T A 1: 60,290,006 Y2194* probably null Het
Olfr767 T A 10: 129,079,961 M1L probably benign Het
Olfr867 A T 9: 20,055,365 S33T probably benign Het
Rab6b T C 9: 103,167,124 S172P probably benign Het
Ror1 T A 4: 100,333,620 L58* probably null Het
Sec23b A G 2: 144,590,338 D756G possibly damaging Het
Slc24a2 T A 4: 87,032,275 K428N probably damaging Het
Spen C A 4: 141,475,752 V1855L probably benign Het
Srgap1 G A 10: 121,785,445 P1071S possibly damaging Het
Tns1 A G 1: 73,941,969 C1079R probably damaging Het
Traf3ip1 G T 1: 91,518,319 probably null Het
Xrn1 A G 9: 96,039,737 D1401G probably damaging Het
Zfp352 T A 4: 90,224,156 S178T possibly damaging Het
Zfp758 G T 17: 22,375,759 E409* probably null Het
Other mutations in Trmt2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Trmt2a APN 16 18249487 missense probably benign
R0050:Trmt2a UTSW 16 18250843 missense probably damaging 1.00
R0050:Trmt2a UTSW 16 18250843 missense probably damaging 1.00
R0377:Trmt2a UTSW 16 18249703 missense possibly damaging 0.68
R0699:Trmt2a UTSW 16 18249529 missense probably benign 0.01
R1114:Trmt2a UTSW 16 18250440 unclassified probably benign
R1882:Trmt2a UTSW 16 18249894 missense possibly damaging 0.88
R1911:Trmt2a UTSW 16 18251206 missense probably benign 0.01
R2184:Trmt2a UTSW 16 18252995 missense probably benign 0.06
R3853:Trmt2a UTSW 16 18251191 missense possibly damaging 0.94
R4427:Trmt2a UTSW 16 18249229 unclassified probably benign
R4737:Trmt2a UTSW 16 18251286 unclassified probably benign
R4896:Trmt2a UTSW 16 18252929 missense probably damaging 0.99
R4903:Trmt2a UTSW 16 18249554 nonsense probably null
R4964:Trmt2a UTSW 16 18249554 nonsense probably null
R4966:Trmt2a UTSW 16 18249554 nonsense probably null
R5216:Trmt2a UTSW 16 18252184 missense probably benign 0.22
R5452:Trmt2a UTSW 16 18250950 missense probably damaging 1.00
R5837:Trmt2a UTSW 16 18249462 unclassified probably benign
R6555:Trmt2a UTSW 16 18253203 missense probably benign 0.03
R6670:Trmt2a UTSW 16 18250477 missense possibly damaging 0.57
R7064:Trmt2a UTSW 16 18253004 missense probably damaging 0.99
R7718:Trmt2a UTSW 16 18250623 missense probably benign 0.16
R8302:Trmt2a UTSW 16 18249949 missense probably damaging 1.00
R8463:Trmt2a UTSW 16 18251175 missense probably damaging 1.00
R9120:Trmt2a UTSW 16 18249858 missense probably damaging 1.00
R9186:Trmt2a UTSW 16 18251169 missense probably benign 0.00
R9487:Trmt2a UTSW 16 18250950 missense probably damaging 1.00
R9710:Trmt2a UTSW 16 18252177 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGAGCGAGTCATACCAATTAGAGCC -3'
(R):5'- AAACCCAGCTCTGCTTGGGATG -3'

Sequencing Primer
(F):5'- AATTAGAGCCTTCAGCCAGG -3'
(R):5'- GGTCACCACATCGGCAATTTG -3'
Posted On 2014-01-05