Incidental Mutation 'R1120:Cd36'
ID 95475
Institutional Source Beutler Lab
Gene Symbol Cd36
Ensembl Gene ENSMUSG00000002944
Gene Name CD36 molecule
Synonyms FAT, Scarb3, fatty acid translocase
MMRRC Submission 039193-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.146) question?
Stock # R1120 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 17986688-18093799 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 17990826 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 438 (I438T)
Ref Sequence ENSEMBL: ENSMUSP00000143061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082367] [ENSMUST00000165232] [ENSMUST00000169095] [ENSMUST00000170051] [ENSMUST00000197890]
AlphaFold Q08857
Predicted Effect possibly damaging
Transcript: ENSMUST00000082367
AA Change: I438T

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000080974
Gene: ENSMUSG00000002944
AA Change: I438T

DomainStartEndE-ValueType
Pfam:CD36 14 463 2.5e-151 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165232
AA Change: I438T

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000126300
Gene: ENSMUSG00000002944
AA Change: I438T

DomainStartEndE-ValueType
Pfam:CD36 12 465 2.5e-149 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000169095
AA Change: I438T

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131832
Gene: ENSMUSG00000002944
AA Change: I438T

DomainStartEndE-ValueType
Pfam:CD36 12 465 2.5e-149 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170051
AA Change: I438T

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133008
Gene: ENSMUSG00000002944
AA Change: I438T

DomainStartEndE-ValueType
Pfam:CD36 12 465 2.5e-149 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000197890
AA Change: I438T

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000143061
Gene: ENSMUSG00000002944
AA Change: I438T

DomainStartEndE-ValueType
Pfam:CD36 12 465 2.5e-149 PFAM
Meta Mutation Damage Score 0.1291 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the fourth major glycoprotein of the platelet surface and serves as a receptor for thrombospondin in platelets and various cell lines. Since thrombospondins are widely distributed proteins involved in a variety of adhesive processes, this protein may have important functions as a cell adhesion molecule. It binds to collagen, thrombospondin, anionic phospholipids and oxidized LDL. It directly mediates cytoadherence of Plasmodium falciparum parasitized erythrocytes and it binds long chain fatty acids and may function in the transport and/or as a regulator of fatty acid transport. Mutations in this gene cause platelet glycoprotein deficiency. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutant mice exhibit an immunodeficiency phenotype, are susceptible to S. aureus infection and develop ocular pterygium. Mice homozygous for disruptions in this gene display abnormal lipid homeostasis which affects energy utilization in the heart. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T G 5: 24,613,818 (GRCm39) probably null Het
Akp3 A T 1: 87,053,159 (GRCm39) Q77L probably damaging Het
Blm A G 7: 80,131,214 (GRCm39) L878S probably damaging Het
Cabin1 A G 10: 75,561,550 (GRCm39) Y984H probably damaging Het
Cadps2 T C 6: 23,838,793 (GRCm39) Q86R probably damaging Het
Cd2 C T 3: 101,194,804 (GRCm39) D95N probably damaging Het
Crhbp G T 13: 95,578,593 (GRCm39) T176K probably benign Het
D630045J12Rik G T 6: 38,171,705 (GRCm39) T821K probably damaging Het
Disp1 T C 1: 182,880,139 (GRCm39) D288G probably benign Het
Dsc3 A G 18: 20,120,034 (GRCm39) V208A probably benign Het
Eef1e1 A T 13: 38,842,910 (GRCm39) N20K probably damaging Het
Ercc5 A G 1: 44,201,001 (GRCm39) D187G probably damaging Het
Etl4 T A 2: 20,811,514 (GRCm39) M1199K probably benign Het
Fnbp1 A T 2: 30,926,606 (GRCm39) Y433N probably damaging Het
Fxyd3 A G 7: 30,770,803 (GRCm39) probably benign Het
Hfm1 A T 5: 107,052,084 (GRCm39) probably benign Het
Irak2 T A 6: 113,652,720 (GRCm39) probably benign Het
Jpt2 T C 17: 25,179,585 (GRCm39) M1V probably null Het
Knl1 A G 2: 118,892,856 (GRCm39) R51G probably damaging Het
Krtap8-1 A G 16: 89,284,753 (GRCm39) Y15H probably benign Het
Lrba A T 3: 86,202,499 (GRCm39) D250V probably damaging Het
Mgat4a A G 1: 37,491,662 (GRCm39) S357P probably damaging Het
Nup98 T A 7: 101,809,923 (GRCm39) T536S probably damaging Het
Or4a27 A G 2: 88,559,281 (GRCm39) Y221H probably damaging Het
Or4c109 A G 2: 88,818,423 (GRCm39) M41T possibly damaging Het
Or9k2 A G 10: 129,998,406 (GRCm39) L263P probably damaging Het
Parp14 G A 16: 35,677,130 (GRCm39) A946V probably benign Het
Pnpla8 A G 12: 44,351,730 (GRCm39) T568A possibly damaging Het
Ptprn A G 1: 75,234,825 (GRCm39) I254T probably benign Het
Rab5b A C 10: 128,515,483 (GRCm39) N188K probably benign Het
Samd5 A G 10: 9,504,792 (GRCm39) V154A possibly damaging Het
Smarcb1 A G 10: 75,757,157 (GRCm39) F25L probably benign Het
Smchd1 A T 17: 71,665,141 (GRCm39) Y1847* probably null Het
Smpd4 T C 16: 17,456,350 (GRCm39) probably benign Het
Tex14 T A 11: 87,429,502 (GRCm39) probably benign Het
Tnfrsf26 G A 7: 143,171,651 (GRCm39) R101C probably damaging Het
Trmu A G 15: 85,774,486 (GRCm39) K37E possibly damaging Het
Tsen54 C T 11: 115,705,839 (GRCm39) A52V probably damaging Het
Ubb T C 11: 62,443,009 (GRCm39) I13T possibly damaging Het
Vmn2r101 A T 17: 19,797,723 (GRCm39) probably benign Het
Other mutations in Cd36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Cd36 APN 5 17,992,700 (GRCm39) missense probably damaging 0.99
IGL01355:Cd36 APN 5 18,018,072 (GRCm39) missense possibly damaging 0.76
IGL02140:Cd36 APN 5 18,033,766 (GRCm39) splice site probably benign
IGL02385:Cd36 APN 5 18,019,717 (GRCm39) missense probably benign 0.31
IGL02626:Cd36 APN 5 18,002,126 (GRCm39) nonsense probably null
IGL02645:Cd36 APN 5 17,990,878 (GRCm39) missense probably benign 0.01
IGL03149:Cd36 APN 5 18,025,563 (GRCm39) missense probably benign 0.02
detached UTSW 5 18,019,721 (GRCm39) missense probably damaging 1.00
oblivious UTSW 5 18,079,964 (GRCm39) intron probably benign
E0370:Cd36 UTSW 5 17,990,747 (GRCm39) nonsense probably null
F5770:Cd36 UTSW 5 18,025,526 (GRCm39) frame shift probably null
R0266:Cd36 UTSW 5 18,003,250 (GRCm39) missense probably benign 0.09
R1102:Cd36 UTSW 5 18,019,211 (GRCm39) missense possibly damaging 0.79
R1170:Cd36 UTSW 5 18,018,086 (GRCm39) missense probably damaging 1.00
R1551:Cd36 UTSW 5 18,002,120 (GRCm39) missense probably benign 0.00
R1918:Cd36 UTSW 5 18,002,034 (GRCm39) nonsense probably null
R4090:Cd36 UTSW 5 17,990,718 (GRCm39) critical splice donor site probably null
R4197:Cd36 UTSW 5 18,018,086 (GRCm39) missense probably damaging 1.00
R5602:Cd36 UTSW 5 18,019,790 (GRCm39) missense possibly damaging 0.94
R5647:Cd36 UTSW 5 18,019,763 (GRCm39) missense probably damaging 1.00
R5867:Cd36 UTSW 5 17,990,733 (GRCm39) missense probably benign 0.05
R6151:Cd36 UTSW 5 18,000,593 (GRCm39) missense probably damaging 1.00
R6400:Cd36 UTSW 5 18,019,721 (GRCm39) missense probably damaging 1.00
R6419:Cd36 UTSW 5 18,002,150 (GRCm39) missense probably benign
R7081:Cd36 UTSW 5 18,019,702 (GRCm39) missense probably damaging 1.00
R7195:Cd36 UTSW 5 18,019,187 (GRCm39) missense probably damaging 1.00
R7420:Cd36 UTSW 5 17,993,272 (GRCm39) missense probably benign 0.09
R8677:Cd36 UTSW 5 18,025,493 (GRCm39) missense probably damaging 1.00
R9460:Cd36 UTSW 5 18,000,608 (GRCm39) missense probably null 0.10
R9526:Cd36 UTSW 5 18,002,033 (GRCm39) missense probably damaging 0.99
R9747:Cd36 UTSW 5 18,019,732 (GRCm39) missense probably benign 0.19
V7580:Cd36 UTSW 5 18,025,526 (GRCm39) frame shift probably null
Z1088:Cd36 UTSW 5 18,000,573 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- TGGCTGGCATCTACAAGCATCCTC -3'
(R):5'- TTGCTGACACAGGTAGCTGACAC -3'

Sequencing Primer
(F):5'- GATGATAAACTCCTTTACACCTGTG -3'
(R):5'- CAGGTAGCTGACACCTATGC -3'
Posted On 2014-01-05