Incidental Mutation 'R1034:B3gnt5'
ID 95476
Institutional Source Beutler Lab
Gene Symbol B3gnt5
Ensembl Gene ENSMUSG00000022686
Gene Name UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5
Synonyms
MMRRC Submission 039133-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.417) question?
Stock # R1034 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 19760208-19772753 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 19769484 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 151 (Y151C)
Ref Sequence ENSEMBL: ENSMUSP00000126157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079780] [ENSMUST00000119468] [ENSMUST00000121344] [ENSMUST00000164397]
AlphaFold Q8BGY6
Predicted Effect probably damaging
Transcript: ENSMUST00000079780
AA Change: Y151C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078712
Gene: ENSMUSG00000022686
AA Change: Y151C

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Galactosyl_T 100 299 2e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119468
AA Change: Y151C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113145
Gene: ENSMUSG00000022686
AA Change: Y151C

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Galactosyl_T 100 299 2e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121344
AA Change: Y151C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112624
Gene: ENSMUSG00000022686
AA Change: Y151C

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Galactosyl_T 100 299 2e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152845
Predicted Effect probably damaging
Transcript: ENSMUST00000164397
AA Change: Y151C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126157
Gene: ENSMUSG00000022686
AA Change: Y151C

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Galactosyl_T 100 299 2e-49 PFAM
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.3%
  • 10x: 92.9%
  • 20x: 82.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta-1,3-N-acetylglucosaminyltransferase family. This enzyme is a type II membrane protein. It exhibits strong activity to transfer GlcNAc to glycolipid substrates and is identified as the most likely candidate for lactotriaosylceramide synthase. This enzyme is essential for the expression of Lewis X epitopes on glycolipids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice may show variable types of lethality or no lethality depending on the allele. Mice homozygous for 3 alleles show B cell abnormalities. Mice homozygous or heterozygous for 2 allele show reduced fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Abca14 T C 7: 120,216,147 F206S probably damaging Het
Arid2 T C 15: 96,369,505 V622A probably benign Het
Asic1 T A 15: 99,698,058 L437Q probably damaging Het
Atp1b1 C T 1: 164,453,488 probably null Het
Cbx4 A G 11: 119,081,707 S281P probably damaging Het
Dnah5 G A 15: 28,302,471 V1625I probably damaging Het
Eftud2 A C 11: 102,849,184 D461E probably benign Het
Epgn A G 5: 91,032,221 Y74C probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fgf14 C T 14: 124,132,534 V113I probably damaging Het
Ggcx G A 6: 72,414,831 R68H probably damaging Het
Gm1110 A G 9: 26,921,350 S16P probably damaging Het
Gm6729 T C 10: 86,540,026 noncoding transcript Het
Gpr108 A G 17: 57,235,995 F522S probably damaging Het
Gpr156 T C 16: 38,004,726 V435A probably benign Het
Khdrbs2 T C 1: 32,467,791 L172P probably damaging Het
Kmo C T 1: 175,651,618 P240L possibly damaging Het
Ltn1 A T 16: 87,397,137 probably null Het
Nbeal1 T A 1: 60,290,006 Y2194* probably null Het
Olfr767 T A 10: 129,079,961 M1L probably benign Het
Olfr867 A T 9: 20,055,365 S33T probably benign Het
Rab6b T C 9: 103,167,124 S172P probably benign Het
Ror1 T A 4: 100,333,620 L58* probably null Het
Sec23b A G 2: 144,590,338 D756G possibly damaging Het
Slc24a2 T A 4: 87,032,275 K428N probably damaging Het
Spen C A 4: 141,475,752 V1855L probably benign Het
Srgap1 G A 10: 121,785,445 P1071S possibly damaging Het
Tns1 A G 1: 73,941,969 C1079R probably damaging Het
Traf3ip1 G T 1: 91,518,319 probably null Het
Trmt2a T C 16: 18,249,709 F82S probably damaging Het
Xrn1 A G 9: 96,039,737 D1401G probably damaging Het
Zfp352 T A 4: 90,224,156 S178T possibly damaging Het
Zfp758 G T 17: 22,375,759 E409* probably null Het
Other mutations in B3gnt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01352:B3gnt5 APN 16 19769213 missense probably damaging 1.00
IGL01503:B3gnt5 APN 16 19769781 missense probably damaging 1.00
IGL02623:B3gnt5 APN 16 19769610 missense probably damaging 1.00
IGL02978:B3gnt5 APN 16 19769994 missense probably damaging 1.00
IGL03355:B3gnt5 APN 16 19769153 missense probably benign 0.01
IGL03388:B3gnt5 APN 16 19770051 missense possibly damaging 0.83
R0180:B3gnt5 UTSW 16 19769100 missense possibly damaging 0.48
R0973:B3gnt5 UTSW 16 19770010 missense probably damaging 1.00
R0973:B3gnt5 UTSW 16 19770010 missense probably damaging 1.00
R0974:B3gnt5 UTSW 16 19770010 missense probably damaging 1.00
R1435:B3gnt5 UTSW 16 19769174 missense probably damaging 0.99
R1480:B3gnt5 UTSW 16 19769867 missense probably damaging 1.00
R1533:B3gnt5 UTSW 16 19769614 missense probably damaging 1.00
R1920:B3gnt5 UTSW 16 19769544 missense probably benign 0.34
R3962:B3gnt5 UTSW 16 19769048 missense probably benign 0.37
R3963:B3gnt5 UTSW 16 19769048 missense probably benign 0.37
R4620:B3gnt5 UTSW 16 19769882 missense probably benign 0.37
R4948:B3gnt5 UTSW 16 19769144 missense probably benign
R4987:B3gnt5 UTSW 16 19769202 missense probably damaging 1.00
R5027:B3gnt5 UTSW 16 19769694 missense probably damaging 1.00
R6415:B3gnt5 UTSW 16 19770009 missense probably damaging 1.00
R7027:B3gnt5 UTSW 16 19769990 missense probably damaging 1.00
R7224:B3gnt5 UTSW 16 19769753 missense probably benign 0.06
R7261:B3gnt5 UTSW 16 19769373 missense probably damaging 1.00
R7369:B3gnt5 UTSW 16 19769660 missense probably benign 0.00
R8818:B3gnt5 UTSW 16 19769597 missense possibly damaging 0.53
Z1176:B3gnt5 UTSW 16 19769810 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTATGGCCGACGTTCTGCAATC -3'
(R):5'- TTGGCACAGAGGCCCATGAATAC -3'

Sequencing Primer
(F):5'- CGTTCTGCAATCAGAAAAACGTG -3'
(R):5'- TTTTATCCCTAACAGGAGGGC -3'
Posted On 2014-01-05