Mutagenetix > Incidental Mutation

Incidental Mutation 'R1034:B3gnt5'

95476

Institutional Source

Beutler Lab

Gene Symbol

B3gnt5

Ensembl Gene

ENSMUSG00000022686

Gene Name

UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5

Synonyms

MMRRC Submission

039133-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.417) question?

Stock #

R1034 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

19760208-19772753 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 19769484 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 151 (Y151C)

Ref Sequence

ENSEMBL: ENSMUSP00000126157 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079780] [ENSMUST00000119468] [ENSMUST00000121344] [ENSMUST00000164397]

AlphaFold

Q8BGY6

Predicted Effect

probably damaging
Transcript: ENSMUST00000079780
AA Change: Y151C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000078712
Gene: ENSMUSG00000022686
AA Change: Y151C

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
Pfam:Galactosyl_T	100	299	2e-49	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000119468
AA Change: Y151C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113145
Gene: ENSMUSG00000022686
AA Change: Y151C

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
Pfam:Galactosyl_T	100	299	2e-49	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000121344
AA Change: Y151C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112624
Gene: ENSMUSG00000022686
AA Change: Y151C

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
Pfam:Galactosyl_T	100	299	2e-49	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131557

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152845

Predicted Effect

probably damaging
Transcript: ENSMUST00000164397
AA Change: Y151C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126157
Gene: ENSMUSG00000022686
AA Change: Y151C

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
Pfam:Galactosyl_T	100	299	2e-49	PFAM

Coding Region Coverage

1x: 98.7%
3x: 97.3%
10x: 92.9%
20x: 82.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta-1,3-N-acetylglucosaminyltransferase family. This enzyme is a type II membrane protein. It exhibits strong activity to transfer GlcNAc to glycolipid substrates and is identified as the most likely candidate for lactotriaosylceramide synthase. This enzyme is essential for the expression of Lewis X epitopes on glycolipids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice may show variable types of lethality or no lethality depending on the allele. Mice homozygous for 3 alleles show B cell abnormalities. Mice homozygous or heterozygous for 2 allele show reduced fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	G	A	5: 76,876,283	T174M	probably damaging	Het
Abca14	T	C	7: 120,216,147	F206S	probably damaging	Het
Arid2	T	C	15: 96,369,505	V622A	probably benign	Het
Asic1	T	A	15: 99,698,058	L437Q	probably damaging	Het
Atp1b1	C	T	1: 164,453,488		probably null	Het
Cbx4	A	G	11: 119,081,707	S281P	probably damaging	Het
Dnah5	G	A	15: 28,302,471	V1625I	probably damaging	Het
Eftud2	A	C	11: 102,849,184	D461E	probably benign	Het
Epgn	A	G	5: 91,032,221	Y74C	probably damaging	Het
Fcho1	C	T	8: 71,712,560	A418T	probably benign	Het
Fgf14	C	T	14: 124,132,534	V113I	probably damaging	Het
Ggcx	G	A	6: 72,414,831	R68H	probably damaging	Het
Gm1110	A	G	9: 26,921,350	S16P	probably damaging	Het
Gm6729	T	C	10: 86,540,026		noncoding transcript	Het
Gpr108	A	G	17: 57,235,995	F522S	probably damaging	Het
Gpr156	T	C	16: 38,004,726	V435A	probably benign	Het
Khdrbs2	T	C	1: 32,467,791	L172P	probably damaging	Het
Kmo	C	T	1: 175,651,618	P240L	possibly damaging	Het
Ltn1	A	T	16: 87,397,137		probably null	Het
Nbeal1	T	A	1: 60,290,006	Y2194*	probably null	Het
Olfr767	T	A	10: 129,079,961	M1L	probably benign	Het
Olfr867	A	T	9: 20,055,365	S33T	probably benign	Het
Rab6b	T	C	9: 103,167,124	S172P	probably benign	Het
Ror1	T	A	4: 100,333,620	L58*	probably null	Het
Sec23b	A	G	2: 144,590,338	D756G	possibly damaging	Het
Slc24a2	T	A	4: 87,032,275	K428N	probably damaging	Het
Spen	C	A	4: 141,475,752	V1855L	probably benign	Het
Srgap1	G	A	10: 121,785,445	P1071S	possibly damaging	Het
Tns1	A	G	1: 73,941,969	C1079R	probably damaging	Het
Traf3ip1	G	T	1: 91,518,319		probably null	Het
Trmt2a	T	C	16: 18,249,709	F82S	probably damaging	Het
Xrn1	A	G	9: 96,039,737	D1401G	probably damaging	Het
Zfp352	T	A	4: 90,224,156	S178T	possibly damaging	Het
Zfp758	G	T	17: 22,375,759	E409*	probably null	Het

Other mutations in B3gnt5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01352:B3gnt5	APN	16	19769213	missense	probably damaging	1.00
IGL01503:B3gnt5	APN	16	19769781	missense	probably damaging	1.00
IGL02623:B3gnt5	APN	16	19769610	missense	probably damaging	1.00
IGL02978:B3gnt5	APN	16	19769994	missense	probably damaging	1.00
IGL03355:B3gnt5	APN	16	19769153	missense	probably benign	0.01
IGL03388:B3gnt5	APN	16	19770051	missense	possibly damaging	0.83
R0180:B3gnt5	UTSW	16	19769100	missense	possibly damaging	0.48
R0973:B3gnt5	UTSW	16	19770010	missense	probably damaging	1.00
R0973:B3gnt5	UTSW	16	19770010	missense	probably damaging	1.00
R0974:B3gnt5	UTSW	16	19770010	missense	probably damaging	1.00
R1435:B3gnt5	UTSW	16	19769174	missense	probably damaging	0.99
R1480:B3gnt5	UTSW	16	19769867	missense	probably damaging	1.00
R1533:B3gnt5	UTSW	16	19769614	missense	probably damaging	1.00
R1920:B3gnt5	UTSW	16	19769544	missense	probably benign	0.34
R3962:B3gnt5	UTSW	16	19769048	missense	probably benign	0.37
R3963:B3gnt5	UTSW	16	19769048	missense	probably benign	0.37
R4620:B3gnt5	UTSW	16	19769882	missense	probably benign	0.37
R4948:B3gnt5	UTSW	16	19769144	missense	probably benign
R4987:B3gnt5	UTSW	16	19769202	missense	probably damaging	1.00
R5027:B3gnt5	UTSW	16	19769694	missense	probably damaging	1.00
R6415:B3gnt5	UTSW	16	19770009	missense	probably damaging	1.00
R7027:B3gnt5	UTSW	16	19769990	missense	probably damaging	1.00
R7224:B3gnt5	UTSW	16	19769753	missense	probably benign	0.06
R7261:B3gnt5	UTSW	16	19769373	missense	probably damaging	1.00
R7369:B3gnt5	UTSW	16	19769660	missense	probably benign	0.00
R8818:B3gnt5	UTSW	16	19769597	missense	possibly damaging	0.53
Z1176:B3gnt5	UTSW	16	19769810	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACTATGGCCGACGTTCTGCAATC -3'
(R):5'- TTGGCACAGAGGCCCATGAATAC -3'

Sequencing Primer
(F):5'- CGTTCTGCAATCAGAAAAACGTG -3'
(R):5'- TTTTATCCCTAACAGGAGGGC -3'

Posted On

2014-01-05