Mutagenetix > Incidental Mutation

Incidental Mutation 'R1034:Gpr156'

95478

Institutional Source

Beutler Lab

Gene Symbol

Gpr156

Ensembl Gene

ENSMUSG00000046961

Gene Name

G protein-coupled receptor 156

Synonyms

Gababl

MMRRC Submission

039133-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1034 (G1)

Quality Score

214

Status

Not validated

Chromosome

Chromosomal Location

37916496-38007530 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 38004726 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 435 (V435A)

Ref Sequence

ENSEMBL: ENSMUSP00000055958 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061274]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000061274
AA Change: V435A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000055958
Gene: ENSMUSG00000046961
AA Change: V435A

Domain	Start	End	E-Value	Type
low complexity region	38	50	N/A	INTRINSIC
Pfam:7tm_3	61	313	2.6e-37	PFAM
coiled coil region	353	390	N/A	INTRINSIC
low complexity region	584	593	N/A	INTRINSIC
low complexity region	635	648	N/A	INTRINSIC
low complexity region	681	716	N/A	INTRINSIC
low complexity region	729	739	N/A	INTRINSIC
low complexity region	753	766	N/A	INTRINSIC

Coding Region Coverage

1x: 98.7%
3x: 97.3%
10x: 92.9%
20x: 82.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] G protein-coupled receptors (GPCRs) are a large superfamily of cell surface receptors characterized by 7 helical transmembrane domains, together with N-terminal extracellular and C-terminal intracellular domains.[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	G	A	5: 76,876,283	T174M	probably damaging	Het
Abca14	T	C	7: 120,216,147	F206S	probably damaging	Het
Arid2	T	C	15: 96,369,505	V622A	probably benign	Het
Asic1	T	A	15: 99,698,058	L437Q	probably damaging	Het
Atp1b1	C	T	1: 164,453,488		probably null	Het
B3gnt5	A	G	16: 19,769,484	Y151C	probably damaging	Het
Cbx4	A	G	11: 119,081,707	S281P	probably damaging	Het
Dnah5	G	A	15: 28,302,471	V1625I	probably damaging	Het
Eftud2	A	C	11: 102,849,184	D461E	probably benign	Het
Epgn	A	G	5: 91,032,221	Y74C	probably damaging	Het
Fcho1	C	T	8: 71,712,560	A418T	probably benign	Het
Fgf14	C	T	14: 124,132,534	V113I	probably damaging	Het
Ggcx	G	A	6: 72,414,831	R68H	probably damaging	Het
Gm1110	A	G	9: 26,921,350	S16P	probably damaging	Het
Gm6729	T	C	10: 86,540,026		noncoding transcript	Het
Gpr108	A	G	17: 57,235,995	F522S	probably damaging	Het
Khdrbs2	T	C	1: 32,467,791	L172P	probably damaging	Het
Kmo	C	T	1: 175,651,618	P240L	possibly damaging	Het
Ltn1	A	T	16: 87,397,137		probably null	Het
Nbeal1	T	A	1: 60,290,006	Y2194*	probably null	Het
Olfr767	T	A	10: 129,079,961	M1L	probably benign	Het
Olfr867	A	T	9: 20,055,365	S33T	probably benign	Het
Rab6b	T	C	9: 103,167,124	S172P	probably benign	Het
Ror1	T	A	4: 100,333,620	L58*	probably null	Het
Sec23b	A	G	2: 144,590,338	D756G	possibly damaging	Het
Slc24a2	T	A	4: 87,032,275	K428N	probably damaging	Het
Spen	C	A	4: 141,475,752	V1855L	probably benign	Het
Srgap1	G	A	10: 121,785,445	P1071S	possibly damaging	Het
Tns1	A	G	1: 73,941,969	C1079R	probably damaging	Het
Traf3ip1	G	T	1: 91,518,319		probably null	Het
Trmt2a	T	C	16: 18,249,709	F82S	probably damaging	Het
Xrn1	A	G	9: 96,039,737	D1401G	probably damaging	Het
Zfp352	T	A	4: 90,224,156	S178T	possibly damaging	Het
Zfp758	G	T	17: 22,375,759	E409*	probably null	Het

Other mutations in Gpr156

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00943:Gpr156	APN	16	37988576	missense	probably damaging	1.00
IGL01615:Gpr156	APN	16	37988591	missense	probably damaging	1.00
IGL01976:Gpr156	APN	16	37979033	missense	probably damaging	0.97
IGL02217:Gpr156	APN	16	38005311	missense	probably benign	0.19
IGL02515:Gpr156	APN	16	38005679	missense	probably damaging	0.97
IGL02596:Gpr156	APN	16	37978724	missense	probably benign	0.00
IGL03068:Gpr156	APN	16	37992129	missense	probably damaging	0.99
R0690:Gpr156	UTSW	16	37992141	missense	probably damaging	1.00
R1133:Gpr156	UTSW	16	38005321	missense	probably benign	0.10
R1317:Gpr156	UTSW	16	37987567	missense	probably damaging	1.00
R1437:Gpr156	UTSW	16	37988542	missense	probably damaging	0.99
R1484:Gpr156	UTSW	16	37992196	missense	probably damaging	0.99
R1759:Gpr156	UTSW	16	37948221	missense	probably damaging	0.96
R1761:Gpr156	UTSW	16	37987567	missense	probably damaging	1.00
R1998:Gpr156	UTSW	16	37997908	missense	possibly damaging	0.57
R2067:Gpr156	UTSW	16	37978751	missense	probably benign	0.02
R2111:Gpr156	UTSW	16	37978751	missense	probably benign	0.02
R2509:Gpr156	UTSW	16	37947787	missense	probably benign	0.04
R2872:Gpr156	UTSW	16	37992223	missense	probably damaging	0.99
R2872:Gpr156	UTSW	16	37992223	missense	probably damaging	0.99
R3839:Gpr156	UTSW	16	37988600	missense	probably damaging	0.99
R4492:Gpr156	UTSW	16	37992106	missense	probably damaging	0.99
R4988:Gpr156	UTSW	16	37948215	missense	possibly damaging	0.71
R5329:Gpr156	UTSW	16	38005448	missense	probably benign	0.00
R5361:Gpr156	UTSW	16	38005725	missense	probably damaging	0.99
R5386:Gpr156	UTSW	16	37948309	missense	possibly damaging	0.93
R5531:Gpr156	UTSW	16	38005257	missense	probably benign	0.01
R5886:Gpr156	UTSW	16	37979013	missense	probably damaging	1.00
R5942:Gpr156	UTSW	16	38004902	missense	probably benign	0.04
R6345:Gpr156	UTSW	16	37987519	missense	probably damaging	1.00
R7247:Gpr156	UTSW	16	37947741	missense	probably damaging	1.00
R7353:Gpr156	UTSW	16	37992161	missense	probably damaging	1.00
R7954:Gpr156	UTSW	16	37987558	missense	probably damaging	0.97
R8316:Gpr156	UTSW	16	37997974	missense	probably null	0.00
R8333:Gpr156	UTSW	16	37992054	missense	probably damaging	1.00
R8507:Gpr156	UTSW	16	37948236	missense	probably benign
R8770:Gpr156	UTSW	16	38004612	missense	possibly damaging	0.94
R9237:Gpr156	UTSW	16	38005286	nonsense	probably null
R9491:Gpr156	UTSW	16	38005342	missense	probably benign	0.03
R9767:Gpr156	UTSW	16	37997935	missense	probably damaging	1.00
Z1177:Gpr156	UTSW	16	38004863	missense	probably benign	0.22

Predicted Primers

PCR Primer
(F):5'- CTGCAAGAGCAAGTCAGCAACG -3'
(R):5'- GGCCACTCCATCTGCCATTAAACG -3'

Sequencing Primer
(F):5'- AGTCAGCAACGCCAAGG -3'
(R):5'- CATGGGTTCCTGGTCTCCTC -3'

Posted On

2014-01-05