Incidental Mutation 'R1034:Gpr108'
ID 95488
Institutional Source Beutler Lab
Gene Symbol Gpr108
Ensembl Gene ENSMUSG00000005823
Gene Name G protein-coupled receptor 108
Synonyms 1810015L19Rik
MMRRC Submission 039133-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1034 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 57541635-57555446 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 57542995 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 522 (F522S)
Ref Sequence ENSEMBL: ENSMUSP00000005975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005975]
AlphaFold Q91WD0
Predicted Effect probably damaging
Transcript: ENSMUST00000005975
AA Change: F522S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005975
Gene: ENSMUSG00000005823
AA Change: F522S

DomainStartEndE-ValueType
low complexity region 61 75 N/A INTRINSIC
low complexity region 86 103 N/A INTRINSIC
Pfam:Lung_7-TM_R 240 529 2.3e-98 PFAM
low complexity region 535 547 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.3%
  • 10x: 92.9%
  • 20x: 82.2%
Validation Efficiency
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 77,024,130 (GRCm39) T174M probably damaging Het
Abca14 T C 7: 119,815,370 (GRCm39) F206S probably damaging Het
Arid2 T C 15: 96,267,386 (GRCm39) V622A probably benign Het
Asic1 T A 15: 99,595,939 (GRCm39) L437Q probably damaging Het
Atp1b1 C T 1: 164,281,057 (GRCm39) probably null Het
B3gnt5 A G 16: 19,588,234 (GRCm39) Y151C probably damaging Het
Cbx4 A G 11: 118,972,533 (GRCm39) S281P probably damaging Het
Dnah5 G A 15: 28,302,617 (GRCm39) V1625I probably damaging Het
Eftud2 A C 11: 102,740,010 (GRCm39) D461E probably benign Het
Epgn A G 5: 91,180,080 (GRCm39) Y74C probably damaging Het
Fcho1 C T 8: 72,165,204 (GRCm39) A418T probably benign Het
Fgf14 C T 14: 124,369,946 (GRCm39) V113I probably damaging Het
Ggcx G A 6: 72,391,814 (GRCm39) R68H probably damaging Het
Gm1110 A G 9: 26,832,646 (GRCm39) S16P probably damaging Het
Gm6729 T C 10: 86,375,890 (GRCm39) noncoding transcript Het
Gpr156 T C 16: 37,825,088 (GRCm39) V435A probably benign Het
Khdrbs2 T C 1: 32,506,872 (GRCm39) L172P probably damaging Het
Kmo C T 1: 175,479,184 (GRCm39) P240L possibly damaging Het
Ltn1 A T 16: 87,194,025 (GRCm39) probably null Het
Nbeal1 T A 1: 60,329,165 (GRCm39) Y2194* probably null Het
Or6c8 T A 10: 128,915,830 (GRCm39) M1L probably benign Het
Or7d11 A T 9: 19,966,661 (GRCm39) S33T probably benign Het
Rab6b T C 9: 103,044,323 (GRCm39) S172P probably benign Het
Ror1 T A 4: 100,190,817 (GRCm39) L58* probably null Het
Sec23b A G 2: 144,432,258 (GRCm39) D756G possibly damaging Het
Slc24a2 T A 4: 86,950,512 (GRCm39) K428N probably damaging Het
Spen C A 4: 141,203,063 (GRCm39) V1855L probably benign Het
Srgap1 G A 10: 121,621,350 (GRCm39) P1071S possibly damaging Het
Tns1 A G 1: 73,981,128 (GRCm39) C1079R probably damaging Het
Traf3ip1 G T 1: 91,446,041 (GRCm39) probably null Het
Trmt2a T C 16: 18,067,573 (GRCm39) F82S probably damaging Het
Xrn1 A G 9: 95,921,790 (GRCm39) D1401G probably damaging Het
Zfp352 T A 4: 90,112,393 (GRCm39) S178T possibly damaging Het
Zfp758 G T 17: 22,594,740 (GRCm39) E409* probably null Het
Other mutations in Gpr108
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01982:Gpr108 APN 17 57,544,877 (GRCm39) missense probably damaging 1.00
IGL02486:Gpr108 APN 17 57,542,977 (GRCm39) missense probably damaging 1.00
IGL02810:Gpr108 APN 17 57,549,742 (GRCm39) missense probably benign 0.39
IGL03233:Gpr108 APN 17 57,552,042 (GRCm39) missense probably benign 0.00
1mM(1):Gpr108 UTSW 17 57,552,352 (GRCm39) unclassified probably benign
IGL02799:Gpr108 UTSW 17 57,544,482 (GRCm39) missense probably damaging 1.00
PIT4468001:Gpr108 UTSW 17 57,554,563 (GRCm39) missense probably null 0.09
R0391:Gpr108 UTSW 17 57,550,101 (GRCm39) missense probably benign 0.02
R0469:Gpr108 UTSW 17 57,542,358 (GRCm39) missense possibly damaging 0.65
R0510:Gpr108 UTSW 17 57,542,358 (GRCm39) missense possibly damaging 0.65
R0613:Gpr108 UTSW 17 57,545,174 (GRCm39) splice site probably benign
R1141:Gpr108 UTSW 17 57,544,219 (GRCm39) missense probably damaging 1.00
R1748:Gpr108 UTSW 17 57,543,217 (GRCm39) missense probably damaging 0.99
R2000:Gpr108 UTSW 17 57,543,712 (GRCm39) missense probably benign 0.03
R3036:Gpr108 UTSW 17 57,552,323 (GRCm39) missense probably benign 0.01
R4087:Gpr108 UTSW 17 57,544,925 (GRCm39) missense probably damaging 1.00
R4089:Gpr108 UTSW 17 57,544,925 (GRCm39) missense probably damaging 1.00
R5071:Gpr108 UTSW 17 57,542,335 (GRCm39) missense probably damaging 1.00
R5566:Gpr108 UTSW 17 57,543,919 (GRCm39) missense probably damaging 1.00
R6889:Gpr108 UTSW 17 57,543,990 (GRCm39) missense probably damaging 1.00
R7352:Gpr108 UTSW 17 57,543,944 (GRCm39) missense probably damaging 1.00
R7587:Gpr108 UTSW 17 57,543,732 (GRCm39) missense probably damaging 1.00
R7642:Gpr108 UTSW 17 57,543,228 (GRCm39) nonsense probably null
R9574:Gpr108 UTSW 17 57,545,039 (GRCm39) missense probably damaging 1.00
Z1177:Gpr108 UTSW 17 57,544,316 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCACTGAGACCAGCATTAGAGCC -3'
(R):5'- CGTATCATCGCCATTCTGCTGCAAG -3'

Sequencing Primer
(F):5'- ATTAGAGCCACCCATACCTTAC -3'
(R):5'- TGCAAGTAGCAGTGCCCTTC -3'
Posted On 2014-01-05