Mutagenetix > Incidental Mutation

Incidental Mutation 'R1120:Blm'

95498

Institutional Source

Beutler Lab

Gene Symbol

Blm

Ensembl Gene

ENSMUSG00000030528

Gene Name

Bloom syndrome, RecQ like helicase

Synonyms

MMRRC Submission

039193-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1120 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80454733-80535119 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 80481466 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Serine at position 878 (L878S)

Ref Sequence

ENSEMBL: ENSMUSP00000127995 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081314] [ENSMUST00000170315]

AlphaFold

O88700

Predicted Effect

possibly damaging
Transcript: ENSMUST00000081314
AA Change: L875S

PolyPhen 2 Score 0.745 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000080062
Gene: ENSMUSG00000030528
AA Change: L875S

Domain	Start	End	E-Value	Type
low complexity region	46	54	N/A	INTRINSIC
low complexity region	118	132	N/A	INTRINSIC
low complexity region	142	169	N/A	INTRINSIC
low complexity region	219	231	N/A	INTRINSIC
low complexity region	318	335	N/A	INTRINSIC
Pfam:BDHCT	376	416	5.5e-27	PFAM
low complexity region	557	574	N/A	INTRINSIC
DEXDc	672	873	1.59e-29	SMART
HELICc	910	992	1.29e-24	SMART
RQC	1084	1198	1.43e-15	SMART
HRDC	1217	1297	9.4e-20	SMART
low complexity region	1357	1371	N/A	INTRINSIC
low complexity region	1378	1392	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000170315
AA Change: L878S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000127995
Gene: ENSMUSG00000030528
AA Change: L878S

Domain	Start	End	E-Value	Type
Pfam:BLM_N	4	375	1.1e-161	PFAM
Pfam:BDHCT	380	419	6.4e-25	PFAM
Pfam:BDHCT_assoc	433	658	8.8e-108	PFAM
DEXDc	675	876	1.59e-29	SMART
HELICc	913	995	1.29e-24	SMART
Pfam:RecQ_Zn_bind	1006	1078	1.5e-19	PFAM
RQC	1087	1201	1.43e-15	SMART
HRDC	1220	1300	9.4e-20	SMART
low complexity region	1360	1374	N/A	INTRINSIC
low complexity region	1381	1395	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205263

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205584

Meta Mutation Damage Score

0.8910

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 94.2%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Bloom syndrome gene product is related to the RecQ subset of DExH box-containing DNA helicases and has both DNA-stimulated ATPase and ATP-dependent DNA helicase activities. Mutations causing Bloom syndrome delete or alter helicase motifs and may disable the 3'-5' helicase activity. The normal protein may act to suppress inappropriate recombination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are developmentally delayed, with increased apopotosis in the epiblast and severe anemia, dying at embyronic day 13.5; but homozygotes for a cre mediated recombinant allele are viable Bloom syndrome-like mice prone to a wide variety of cancers and showing increased rates of LOH. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb8	T	G	5: 24,408,820		probably null	Het
Akp3	A	T	1: 87,125,437	Q77L	probably damaging	Het
Cabin1	A	G	10: 75,725,716	Y984H	probably damaging	Het
Cadps2	T	C	6: 23,838,794	Q86R	probably damaging	Het
Cd2	C	T	3: 101,287,488	D95N	probably damaging	Het
Cd36	A	G	5: 17,785,828	I438T	possibly damaging	Het
Crhbp	G	T	13: 95,442,085	T176K	probably benign	Het
D630045J12Rik	G	T	6: 38,194,770	T821K	probably damaging	Het
Disp1	T	C	1: 183,098,575	D288G	probably benign	Het
Dsc3	A	G	18: 19,986,977	V208A	probably benign	Het
Eef1e1	A	T	13: 38,658,934	N20K	probably damaging	Het
Ercc5	A	G	1: 44,161,841	D187G	probably damaging	Het
Etl4	T	A	2: 20,806,703	M1199K	probably benign	Het
Fnbp1	A	T	2: 31,036,594	Y433N	probably damaging	Het
Fxyd3	A	G	7: 31,071,378		probably benign	Het
Hfm1	A	T	5: 106,904,218		probably benign	Het
Irak2	T	A	6: 113,675,759		probably benign	Het
Jpt2	T	C	17: 24,960,611	M1V	probably null	Het
Knl1	A	G	2: 119,062,375	R51G	probably damaging	Het
Krtap8-1	A	G	16: 89,487,865	Y15H	probably benign	Het
Lrba	A	T	3: 86,295,192	D250V	probably damaging	Het
Mgat4a	A	G	1: 37,452,581	S357P	probably damaging	Het
Nup98	T	A	7: 102,160,716	T536S	probably damaging	Het
Olfr1197	A	G	2: 88,728,937	Y221H	probably damaging	Het
Olfr1214	A	G	2: 88,988,079	M41T	possibly damaging	Het
Olfr825	A	G	10: 130,162,537	L263P	probably damaging	Het
Parp14	G	A	16: 35,856,760	A946V	probably benign	Het
Pnpla8	A	G	12: 44,304,947	T568A	possibly damaging	Het
Ptprn	A	G	1: 75,258,181	I254T	probably benign	Het
Rab5b	A	C	10: 128,679,614	N188K	probably benign	Het
Samd5	A	G	10: 9,629,048	V154A	possibly damaging	Het
Smarcb1	A	G	10: 75,921,323	F25L	probably benign	Het
Smchd1	A	T	17: 71,358,146	Y1847*	probably null	Het
Smpd4	T	C	16: 17,638,486		probably benign	Het
Tex14	T	A	11: 87,538,676		probably benign	Het
Tnfrsf26	G	A	7: 143,617,914	R101C	probably damaging	Het
Trmu	A	G	15: 85,890,285	K37E	possibly damaging	Het
Tsen54	C	T	11: 115,815,013	A52V	probably damaging	Het
Ubb	T	C	11: 62,552,183	I13T	possibly damaging	Het
Vmn2r101	A	T	17: 19,577,461		probably benign	Het

Other mutations in Blm

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01531:Blm	APN	7	80474071	missense	probably damaging	1.00
IGL01658:Blm	APN	7	80463941	missense	probably damaging	0.98
IGL02048:Blm	APN	7	80502961	splice site	probably benign
IGL02060:Blm	APN	7	80514580	splice site	probably benign
IGL02063:Blm	APN	7	80509419	nonsense	probably null
IGL02102:Blm	APN	7	80469756	missense	probably damaging	1.00
IGL02420:Blm	APN	7	80496006	missense	probably damaging	1.00
IGL02452:Blm	APN	7	80503377	splice site	probably null
IGL02566:Blm	APN	7	80474196	missense	probably damaging	1.00
IGL03387:Blm	APN	7	80494147	missense	probably damaging	1.00
FR4304:Blm	UTSW	7	80463773	frame shift	probably null
FR4304:Blm	UTSW	7	80512919	small insertion	probably benign
FR4340:Blm	UTSW	7	80463767	unclassified	probably benign
FR4340:Blm	UTSW	7	80512907	small insertion	probably benign
FR4340:Blm	UTSW	7	80512910	small insertion	probably benign
FR4449:Blm	UTSW	7	80512908	small insertion	probably benign
FR4548:Blm	UTSW	7	80463769	frame shift	probably null
FR4589:Blm	UTSW	7	80463770	frame shift	probably null
FR4737:Blm	UTSW	7	80463771	frame shift	probably null
FR4737:Blm	UTSW	7	80463774	frame shift	probably null
FR4976:Blm	UTSW	7	80463767	unclassified	probably benign
FR4976:Blm	UTSW	7	80512907	small insertion	probably benign
R0133:Blm	UTSW	7	80502367	missense	possibly damaging	0.93
R0194:Blm	UTSW	7	80464946	unclassified	probably benign
R0526:Blm	UTSW	7	80505893	nonsense	probably null
R0673:Blm	UTSW	7	80499751	critical splice donor site	probably null
R0972:Blm	UTSW	7	80513370	missense	probably benign
R0980:Blm	UTSW	7	80499958	splice site	probably null
R1301:Blm	UTSW	7	80455417	nonsense	probably null
R1769:Blm	UTSW	7	80513370	missense	probably benign
R1866:Blm	UTSW	7	80494114	missense	probably benign	0.08
R1874:Blm	UTSW	7	80497418	missense	probably damaging	1.00
R1966:Blm	UTSW	7	80513186	missense	possibly damaging	0.86
R1991:Blm	UTSW	7	80505949	splice site	probably null
R2013:Blm	UTSW	7	80502399	missense	probably damaging	0.99
R2014:Blm	UTSW	7	80502399	missense	probably damaging	0.99
R2015:Blm	UTSW	7	80502399	missense	probably damaging	0.99
R2016:Blm	UTSW	7	80505926	missense	probably benign	0.26
R2103:Blm	UTSW	7	80505949	splice site	probably null
R2161:Blm	UTSW	7	80481370	splice site	probably null
R2215:Blm	UTSW	7	80499847	missense	possibly damaging	0.69
R3689:Blm	UTSW	7	80513079	missense	possibly damaging	0.56
R4049:Blm	UTSW	7	80502862	missense	probably benign	0.04
R4155:Blm	UTSW	7	80512904	small deletion	probably benign
R4695:Blm	UTSW	7	80494228	missense	probably damaging	1.00
R4774:Blm	UTSW	7	80463848	missense	probably damaging	1.00
R4833:Blm	UTSW	7	80466826	missense	probably benign
R4835:Blm	UTSW	7	80509546	missense	probably benign	0.41
R4994:Blm	UTSW	7	80458825	missense	probably benign	0.00
R5039:Blm	UTSW	7	80505873	missense	possibly damaging	0.50
R5330:Blm	UTSW	7	80458936	missense	possibly damaging	0.73
R5375:Blm	UTSW	7	80513229	missense	probably benign	0.00
R5408:Blm	UTSW	7	80502622	missense	probably benign	0.01
R5574:Blm	UTSW	7	80499773	missense	probably damaging	1.00
R5606:Blm	UTSW	7	80460832	splice site	probably null
R5702:Blm	UTSW	7	80458927	missense	probably benign	0.13
R5809:Blm	UTSW	7	80464844	missense	probably damaging	1.00
R6114:Blm	UTSW	7	80513487	missense	probably damaging	1.00
R6157:Blm	UTSW	7	80512985	missense	probably benign	0.18
R6163:Blm	UTSW	7	80512904	small deletion	probably benign
R6254:Blm	UTSW	7	80480342	missense	probably benign	0.04
R6266:Blm	UTSW	7	80499940	missense	probably benign	0.03
R6364:Blm	UTSW	7	80494526	nonsense	probably null
R6446:Blm	UTSW	7	80512904	small deletion	probably benign
R6502:Blm	UTSW	7	80481475	missense	probably damaging	0.98
R6700:Blm	UTSW	7	80463850	missense	possibly damaging	0.91
R7002:Blm	UTSW	7	80469753	missense	probably benign	0.00
R7105:Blm	UTSW	7	80499768	missense	probably benign	0.44
R7320:Blm	UTSW	7	80455354	nonsense	probably null
R7465:Blm	UTSW	7	80513115	missense	probably benign	0.02
R7561:Blm	UTSW	7	80502528	missense	probably damaging	0.99
R8500:Blm	UTSW	7	80455284	missense	probably damaging	1.00
R8543:Blm	UTSW	7	80494216	missense	probably damaging	0.98
R8774-TAIL:Blm	UTSW	7	80512907	small insertion	probably benign
R8774-TAIL:Blm	UTSW	7	80512918	small insertion	probably benign
R8774-TAIL:Blm	UTSW	7	80512919	small insertion	probably benign
R8775-TAIL:Blm	UTSW	7	80512931	small insertion	probably benign
R8860:Blm	UTSW	7	80494528	missense	probably benign	0.30
R8928:Blm	UTSW	7	80512904	small deletion	probably benign
R9089:Blm	UTSW	7	80513119	missense	probably damaging	1.00
R9363:Blm	UTSW	7	80458915	missense	probably damaging	1.00
RF001:Blm	UTSW	7	80512903	small insertion	probably benign
RF001:Blm	UTSW	7	80512906	small insertion	probably benign
RF001:Blm	UTSW	7	80512927	small insertion	probably benign
RF002:Blm	UTSW	7	80512905	small insertion	probably benign
RF002:Blm	UTSW	7	80512927	small insertion	probably benign
RF007:Blm	UTSW	7	80512933	nonsense	probably null
RF016:Blm	UTSW	7	80512926	nonsense	probably null
RF018:Blm	UTSW	7	80512926	nonsense	probably null
RF027:Blm	UTSW	7	80512914	frame shift	probably null
RF028:Blm	UTSW	7	80512905	nonsense	probably null
RF031:Blm	UTSW	7	80512906	small insertion	probably benign
RF031:Blm	UTSW	7	80512923	small insertion	probably benign
RF032:Blm	UTSW	7	80512930	small insertion	probably benign
RF036:Blm	UTSW	7	80512914	nonsense	probably null
RF044:Blm	UTSW	7	80512930	small insertion	probably benign
RF053:Blm	UTSW	7	80512921	small insertion	probably benign
RF064:Blm	UTSW	7	80512923	nonsense	probably null
X0061:Blm	UTSW	7	80458850	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- GACACCGACACCAAGAATGAGAATGTAA -3'
(R):5'- TGCTACCTTCACttgagctgctg -3'

Sequencing Primer
(F):5'- ATATTCCCTACAATTAGCAAGTTGG -3'
(R):5'- tgacctccttagtgactctacc -3'

Posted On

2014-01-05