Incidental Mutation 'R1035:Stk17b'
ID 95499
Institutional Source Beutler Lab
Gene Symbol Stk17b
Ensembl Gene ENSMUSG00000026094
Gene Name serine/threonine kinase 17b (apoptosis-inducing)
Synonyms 3110009A03Rik, Drak2
MMRRC Submission 039134-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R1035 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 53794671-53824374 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 53801758 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 88 (T88A)
Ref Sequence ENSEMBL: ENSMUSP00000139880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027263] [ENSMUST00000185920]
AlphaFold Q8BG48
Predicted Effect probably benign
Transcript: ENSMUST00000027263
AA Change: T216A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000027263
Gene: ENSMUSG00000026094
AA Change: T216A

DomainStartEndE-ValueType
S_TKc 33 293 5.77e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185920
AA Change: T88A

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000139880
Gene: ENSMUSG00000026094
AA Change: T88A

DomainStartEndE-ValueType
S_TKc 1 93 5.8e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187066
Meta Mutation Damage Score 0.1671 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.4%
Validation Efficiency 97% (36/37)
MGI Phenotype PHENOTYPE: Homozygous null mice display abnormal T cell numbers, increased T cell proliferation, abnormal cytokine physiology, and decreased susceptibility to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 77,024,130 (GRCm39) T174M probably damaging Het
Ap3b2 A T 7: 81,113,659 (GRCm39) L850Q unknown Het
Asxl3 T C 18: 22,658,106 (GRCm39) S2039P probably damaging Het
Cadm2 A T 16: 66,612,235 (GRCm39) M109K probably damaging Het
Caskin1 A G 17: 24,724,011 (GRCm39) N933S probably damaging Het
Cbln4 T C 2: 171,883,989 (GRCm39) N77S possibly damaging Het
Chek1 A G 9: 36,627,769 (GRCm39) I256T probably damaging Het
Col5a3 A T 9: 20,704,795 (GRCm39) probably benign Het
Cyp2b10 C T 7: 25,616,473 (GRCm39) S360L probably benign Het
Dctn1 T C 6: 83,167,202 (GRCm39) S222P probably damaging Het
Dnah7b A G 1: 46,163,608 (GRCm39) I471V probably benign Het
Ear2 A T 14: 44,340,344 (GRCm39) M1L possibly damaging Het
Entpd6 T A 2: 150,606,112 (GRCm39) probably benign Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,084,988 (GRCm39) probably benign Het
Fam98b C T 2: 117,101,120 (GRCm39) R311W possibly damaging Het
Ggt7 A T 2: 155,348,347 (GRCm39) C102S probably damaging Het
Myo15a T C 11: 60,401,384 (GRCm39) probably benign Het
Nlrp9c C T 7: 26,070,702 (GRCm39) probably benign Het
Nrxn1 A T 17: 90,471,302 (GRCm39) N1234K probably damaging Het
Or5ac19 C T 16: 59,089,307 (GRCm39) C241Y probably damaging Het
Pcsk1 T C 13: 75,280,238 (GRCm39) S688P probably benign Het
Polr1a T C 6: 71,944,900 (GRCm39) F1319L probably benign Het
Ppig T C 2: 69,579,803 (GRCm39) Y446H unknown Het
Spmap2 G A 10: 79,419,684 (GRCm39) T182M probably damaging Het
Tas2r143 A T 6: 42,377,199 (GRCm39) I10F probably benign Het
Tmprss12 G A 15: 100,183,081 (GRCm39) R141Q probably benign Het
Trpa1 A G 1: 14,961,527 (GRCm39) probably null Het
Txndc16 A G 14: 45,410,020 (GRCm39) S187P possibly damaging Het
Vmn2r98 T C 17: 19,301,011 (GRCm39) I671T possibly damaging Het
Zfp78 G T 7: 6,381,660 (GRCm39) V237F probably damaging Het
Other mutations in Stk17b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Stk17b APN 1 53,803,299 (GRCm39) missense probably damaging 0.99
IGL00767:Stk17b APN 1 53,803,182 (GRCm39) splice site probably benign
IGL01012:Stk17b APN 1 53,800,196 (GRCm39) missense probably benign 0.06
IGL01431:Stk17b APN 1 53,805,074 (GRCm39) splice site probably benign
IGL01914:Stk17b APN 1 53,800,226 (GRCm39) missense probably damaging 0.98
IGL02236:Stk17b APN 1 53,803,247 (GRCm39) missense probably damaging 1.00
IGL02827:Stk17b APN 1 53,815,701 (GRCm39) missense probably benign 0.03
R0013:Stk17b UTSW 1 53,803,291 (GRCm39) missense probably benign 0.36
R0545:Stk17b UTSW 1 53,801,742 (GRCm39) splice site probably benign
R0831:Stk17b UTSW 1 53,796,651 (GRCm39) missense probably damaging 1.00
R1375:Stk17b UTSW 1 53,805,106 (GRCm39) missense possibly damaging 0.83
R1576:Stk17b UTSW 1 53,796,749 (GRCm39) missense probably damaging 1.00
R1809:Stk17b UTSW 1 53,805,140 (GRCm39) missense possibly damaging 0.80
R1988:Stk17b UTSW 1 53,800,241 (GRCm39) missense probably damaging 1.00
R2033:Stk17b UTSW 1 53,800,235 (GRCm39) missense probably damaging 1.00
R2105:Stk17b UTSW 1 53,815,764 (GRCm39) missense probably benign 0.01
R2255:Stk17b UTSW 1 53,815,731 (GRCm39) missense probably benign 0.00
R4395:Stk17b UTSW 1 53,803,274 (GRCm39) missense probably damaging 0.98
R4521:Stk17b UTSW 1 53,803,197 (GRCm39) missense probably damaging 1.00
R4777:Stk17b UTSW 1 53,810,867 (GRCm39) missense probably damaging 1.00
R4871:Stk17b UTSW 1 53,796,693 (GRCm39) missense probably benign 0.14
R4892:Stk17b UTSW 1 53,810,770 (GRCm39) missense probably damaging 0.99
R4999:Stk17b UTSW 1 53,800,306 (GRCm39) splice site probably null
R5122:Stk17b UTSW 1 53,815,717 (GRCm39) missense probably damaging 1.00
R5621:Stk17b UTSW 1 53,810,943 (GRCm39) nonsense probably null
R6636:Stk17b UTSW 1 53,800,247 (GRCm39) missense probably damaging 1.00
R6924:Stk17b UTSW 1 53,800,218 (GRCm39) missense possibly damaging 0.54
R7283:Stk17b UTSW 1 53,796,674 (GRCm39) missense probably benign
R7322:Stk17b UTSW 1 53,805,104 (GRCm39) missense probably benign 0.16
R7671:Stk17b UTSW 1 53,805,159 (GRCm39) missense probably damaging 0.99
R8984:Stk17b UTSW 1 53,796,784 (GRCm39) missense probably benign 0.05
R9476:Stk17b UTSW 1 53,796,898 (GRCm39) missense probably damaging 1.00
R9510:Stk17b UTSW 1 53,796,898 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCTGGCTCAAGAGCTTACTGAGAA -3'
(R):5'- GCTTGGTCCACTGCCCACTT -3'

Sequencing Primer
(F):5'- gcccaccccaaaatctgtatc -3'
(R):5'- GCCCACTTCTTCATGAGATTTTC -3'
Posted On 2014-01-05