Incidental Mutation 'R1035:Ppig'
ID95501
Institutional Source Beutler Lab
Gene Symbol Ppig
Ensembl Gene ENSMUSG00000042133
Gene Namepeptidyl-prolyl isomerase G (cyclophilin G)
SynonymsSRCyp, B230312B02Rik
MMRRC Submission 039134-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.820) question?
Stock #R1035 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location69722545-69754012 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69749459 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 446 (Y446H)
Ref Sequence ENSEMBL: ENSMUSP00000088370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040915] [ENSMUST00000090858]
Predicted Effect unknown
Transcript: ENSMUST00000040915
AA Change: Y446H
SMART Domains Protein: ENSMUSP00000045945
Gene: ENSMUSG00000042133
AA Change: Y446H

DomainStartEndE-ValueType
Pfam:Pro_isomerase 11 176 2.8e-50 PFAM
low complexity region 180 258 N/A INTRINSIC
low complexity region 272 280 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
low complexity region 334 354 N/A INTRINSIC
low complexity region 417 433 N/A INTRINSIC
low complexity region 441 478 N/A INTRINSIC
internal_repeat_1 483 518 1.1e-9 PROSPERO
internal_repeat_2 485 555 1.1e-9 PROSPERO
internal_repeat_3 506 556 4.26e-7 PROSPERO
internal_repeat_1 521 556 1.1e-9 PROSPERO
low complexity region 559 586 N/A INTRINSIC
low complexity region 591 637 N/A INTRINSIC
internal_repeat_3 646 693 4.26e-7 PROSPERO
internal_repeat_4 653 686 6.68e-6 PROSPERO
internal_repeat_2 661 735 1.1e-9 PROSPERO
internal_repeat_4 711 744 6.68e-6 PROSPERO
Predicted Effect unknown
Transcript: ENSMUST00000090858
AA Change: Y446H
SMART Domains Protein: ENSMUSP00000088370
Gene: ENSMUSG00000042133
AA Change: Y446H

DomainStartEndE-ValueType
Pfam:Pro_isomerase 11 176 2.7e-49 PFAM
low complexity region 180 258 N/A INTRINSIC
low complexity region 272 280 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
low complexity region 334 354 N/A INTRINSIC
low complexity region 417 433 N/A INTRINSIC
low complexity region 441 478 N/A INTRINSIC
internal_repeat_1 483 518 1.1e-9 PROSPERO
internal_repeat_2 485 555 1.1e-9 PROSPERO
internal_repeat_3 506 556 4.26e-7 PROSPERO
internal_repeat_1 521 556 1.1e-9 PROSPERO
low complexity region 559 586 N/A INTRINSIC
low complexity region 591 637 N/A INTRINSIC
internal_repeat_3 646 693 4.26e-7 PROSPERO
internal_repeat_4 653 686 6.68e-6 PROSPERO
internal_repeat_2 661 735 1.1e-9 PROSPERO
internal_repeat_4 711 744 6.68e-6 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143954
Meta Mutation Damage Score 0.0671 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.4%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Ap3b2 A T 7: 81,463,911 L850Q unknown Het
Asxl3 T C 18: 22,525,049 S2039P probably damaging Het
Cadm2 A T 16: 66,815,347 M109K probably damaging Het
Caskin1 A G 17: 24,505,037 N933S probably damaging Het
Cbln4 T C 2: 172,042,069 N77S possibly damaging Het
Chek1 A G 9: 36,716,473 I256T probably damaging Het
Col5a3 A T 9: 20,793,499 probably benign Het
Cyp2b10 C T 7: 25,917,048 S360L probably benign Het
Dctn1 T C 6: 83,190,220 S222P probably damaging Het
Dnah7b A G 1: 46,124,448 I471V probably benign Het
Ear2 A T 14: 44,102,887 M1L possibly damaging Het
Entpd6 T A 2: 150,764,192 probably benign Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fam98b C T 2: 117,270,639 R311W possibly damaging Het
Ggt7 A T 2: 155,506,427 C102S probably damaging Het
Myo15 T C 11: 60,510,558 probably benign Het
Nlrp9c C T 7: 26,371,277 probably benign Het
Nrxn1 A T 17: 90,163,874 N1234K probably damaging Het
Olfr201 C T 16: 59,268,944 C241Y probably damaging Het
Pcsk1 T C 13: 75,132,119 S688P probably benign Het
Polr1a T C 6: 71,967,916 F1319L probably benign Het
Stk17b T C 1: 53,762,599 T88A probably benign Het
Tas2r143 A T 6: 42,400,265 I10F probably benign Het
Theg G A 10: 79,583,850 T182M probably damaging Het
Tmprss12 G A 15: 100,285,200 R141Q probably benign Het
Trpa1 A G 1: 14,891,303 probably null Het
Txndc16 A G 14: 45,172,563 S187P possibly damaging Het
Vmn2r98 T C 17: 19,080,749 I671T possibly damaging Het
Zfp78 G T 7: 6,378,661 V237F probably damaging Het
Other mutations in Ppig
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Ppig APN 2 69749716 missense unknown
IGL00780:Ppig APN 2 69732924 missense possibly damaging 0.89
IGL02043:Ppig APN 2 69735983 splice site probably null
IGL02420:Ppig APN 2 69732227 missense probably benign 0.03
IGL02736:Ppig APN 2 69736094 missense probably damaging 1.00
R0358:Ppig UTSW 2 69743598 splice site probably benign
R0396:Ppig UTSW 2 69735976 unclassified probably benign
R1159:Ppig UTSW 2 69750224 missense unknown
R1396:Ppig UTSW 2 69749018 missense unknown
R1593:Ppig UTSW 2 69749081 missense unknown
R1629:Ppig UTSW 2 69735873 missense probably damaging 1.00
R1799:Ppig UTSW 2 69749400 missense unknown
R2001:Ppig UTSW 2 69741644 missense unknown
R2112:Ppig UTSW 2 69750107 missense unknown
R3702:Ppig UTSW 2 69733209 missense probably damaging 1.00
R3855:Ppig UTSW 2 69749375 missense unknown
R4999:Ppig UTSW 2 69741486 missense unknown
R5001:Ppig UTSW 2 69741486 missense unknown
R5153:Ppig UTSW 2 69749650 missense unknown
R5218:Ppig UTSW 2 69732783 intron probably benign
R5336:Ppig UTSW 2 69750224 missense unknown
R5410:Ppig UTSW 2 69735897 missense probably null 1.00
R5443:Ppig UTSW 2 69734291 missense probably damaging 1.00
R5513:Ppig UTSW 2 69750359 missense probably benign 0.23
R6179:Ppig UTSW 2 69750127 missense unknown
R6333:Ppig UTSW 2 69749558 missense unknown
R6604:Ppig UTSW 2 69741581 missense unknown
R6932:Ppig UTSW 2 69732411 missense probably benign 0.40
R7206:Ppig UTSW 2 69741566 missense unknown
R7220:Ppig UTSW 2 69749976 missense unknown
R7308:Ppig UTSW 2 69749462 missense unknown
Predicted Primers PCR Primer
(F):5'- TCCACATTGGAGACAAGAGATGCAGA -3'
(R):5'- AGATCCCGTTCTCTACTCCTGGACT -3'

Sequencing Primer
(F):5'- GCTTTTTTACTGCTGAGCACAATG -3'
(R):5'- TGATTCTACCTGTTTGGAGTTCTC -3'
Posted On2014-01-05