Incidental Mutation 'R1035:Entpd6'
ID95505
Institutional Source Beutler Lab
Gene Symbol Entpd6
Ensembl Gene ENSMUSG00000033068
Gene Nameectonucleoside triphosphate diphosphohydrolase 6
SynonymsNTPDase-6, 2700026H11Rik, Cd39l2
MMRRC Submission 039134-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1035 (G1)
Quality Score198
Status Validated
Chromosome2
Chromosomal Location150749042-150771675 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 150764192 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000092038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094467]
Predicted Effect probably benign
Transcript: ENSMUST00000094467
SMART Domains Protein: ENSMUSP00000092038
Gene: ENSMUSG00000033068

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
low complexity region 37 51 N/A INTRINSIC
Pfam:GDA1_CD39 65 453 7.2e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146517
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147223
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.4%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ENTPD6 is similar to E-type nucleotidases (NTPases). NTPases, such as CD39, mediate catabolism of extracellular nucleotides. ENTPD6 contains 4 apyrase-conserved regions which are characteristic of NTPases. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Ap3b2 A T 7: 81,463,911 L850Q unknown Het
Asxl3 T C 18: 22,525,049 S2039P probably damaging Het
Cadm2 A T 16: 66,815,347 M109K probably damaging Het
Caskin1 A G 17: 24,505,037 N933S probably damaging Het
Cbln4 T C 2: 172,042,069 N77S possibly damaging Het
Chek1 A G 9: 36,716,473 I256T probably damaging Het
Col5a3 A T 9: 20,793,499 probably benign Het
Cyp2b10 C T 7: 25,917,048 S360L probably benign Het
Dctn1 T C 6: 83,190,220 S222P probably damaging Het
Dnah7b A G 1: 46,124,448 I471V probably benign Het
Ear2 A T 14: 44,102,887 M1L possibly damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fam98b C T 2: 117,270,639 R311W possibly damaging Het
Ggt7 A T 2: 155,506,427 C102S probably damaging Het
Myo15 T C 11: 60,510,558 probably benign Het
Nlrp9c C T 7: 26,371,277 probably benign Het
Nrxn1 A T 17: 90,163,874 N1234K probably damaging Het
Olfr201 C T 16: 59,268,944 C241Y probably damaging Het
Pcsk1 T C 13: 75,132,119 S688P probably benign Het
Polr1a T C 6: 71,967,916 F1319L probably benign Het
Ppig T C 2: 69,749,459 Y446H unknown Het
Stk17b T C 1: 53,762,599 T88A probably benign Het
Tas2r143 A T 6: 42,400,265 I10F probably benign Het
Theg G A 10: 79,583,850 T182M probably damaging Het
Tmprss12 G A 15: 100,285,200 R141Q probably benign Het
Trpa1 A G 1: 14,891,303 probably null Het
Txndc16 A G 14: 45,172,563 S187P possibly damaging Het
Vmn2r98 T C 17: 19,080,749 I671T possibly damaging Het
Zfp78 G T 7: 6,378,661 V237F probably damaging Het
Other mutations in Entpd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01890:Entpd6 APN 2 150770692 missense possibly damaging 0.76
IGL01980:Entpd6 APN 2 150762366 splice site probably null
IGL03208:Entpd6 APN 2 150768918 missense probably damaging 0.96
R0057:Entpd6 UTSW 2 150758828 missense probably null 0.90
R0403:Entpd6 UTSW 2 150760170 missense possibly damaging 0.95
R1485:Entpd6 UTSW 2 150768923 critical splice donor site probably null
R1532:Entpd6 UTSW 2 150758750 missense probably benign 0.02
R1921:Entpd6 UTSW 2 150758812 missense probably damaging 1.00
R4772:Entpd6 UTSW 2 150767094 missense probably damaging 1.00
R5026:Entpd6 UTSW 2 150763644 missense probably damaging 1.00
R5356:Entpd6 UTSW 2 150770383 missense probably damaging 1.00
R6944:Entpd6 UTSW 2 150763599 missense probably damaging 1.00
R7857:Entpd6 UTSW 2 150765553 critical splice donor site probably null
R7949:Entpd6 UTSW 2 150770277 splice site probably null
Predicted Primers PCR Primer
(F):5'- TAGAATCTGCCTGCCTTGCTGCTG -3'
(R):5'- AAGGGCCATCTGTACCCTGTCTTAC -3'

Sequencing Primer
(F):5'- GCGTGTACAGATTCCATTAGAGC -3'
(R):5'- TACCTTAGACCTGGACATATTCCAC -3'
Posted On2014-01-05