Incidental Mutation 'R1035:Ggt7'
ID95507
Institutional Source Beutler Lab
Gene Symbol Ggt7
Ensembl Gene ENSMUSG00000027603
Gene Namegamma-glutamyltransferase 7
Synonyms1110017C11Rik, 6330563L03Rik, Ggtl3
MMRRC Submission 039134-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.470) question?
Stock #R1035 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location155490379-155518237 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 155506427 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 102 (C102S)
Ref Sequence ENSEMBL: ENSMUSP00000120560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029131] [ENSMUST00000147601] [ENSMUST00000176117]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029131
AA Change: C102S

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000029131
Gene: ENSMUSG00000027603
AA Change: C102S

DomainStartEndE-ValueType
low complexity region 28 42 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
transmembrane domain 109 131 N/A INTRINSIC
Pfam:G_glu_transpept 154 655 1.4e-143 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000147601
AA Change: C102S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120560
Gene: ENSMUSG00000027603
AA Change: C102S

DomainStartEndE-ValueType
low complexity region 28 42 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
transmembrane domain 109 131 N/A INTRINSIC
Pfam:G_glu_transpept 154 202 6.6e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148296
Predicted Effect possibly damaging
Transcript: ENSMUST00000176117
AA Change: C26S

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135314
Gene: ENSMUSG00000027603
AA Change: C26S

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Pfam:G_glu_transpept 78 271 1.4e-63 PFAM
Meta Mutation Damage Score 0.3474 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.4%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a gene family that encodes enzymes involved in both the metabolism of glutathione and in the transpeptidation of amino acids. Changes in the activity of gamma-glutamyltransferase may signal preneoplastic or toxic conditions in the liver or kidney. The protein encoded by this gene consists of a heavy and a light chain, and it can interact with CT120, a plasma membrane-associated protein that is possibly involved in lung carcinogenesis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Ap3b2 A T 7: 81,463,911 L850Q unknown Het
Asxl3 T C 18: 22,525,049 S2039P probably damaging Het
Cadm2 A T 16: 66,815,347 M109K probably damaging Het
Caskin1 A G 17: 24,505,037 N933S probably damaging Het
Cbln4 T C 2: 172,042,069 N77S possibly damaging Het
Chek1 A G 9: 36,716,473 I256T probably damaging Het
Col5a3 A T 9: 20,793,499 probably benign Het
Cyp2b10 C T 7: 25,917,048 S360L probably benign Het
Dctn1 T C 6: 83,190,220 S222P probably damaging Het
Dnah7b A G 1: 46,124,448 I471V probably benign Het
Ear2 A T 14: 44,102,887 M1L possibly damaging Het
Entpd6 T A 2: 150,764,192 probably benign Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fam98b C T 2: 117,270,639 R311W possibly damaging Het
Myo15 T C 11: 60,510,558 probably benign Het
Nlrp9c C T 7: 26,371,277 probably benign Het
Nrxn1 A T 17: 90,163,874 N1234K probably damaging Het
Olfr201 C T 16: 59,268,944 C241Y probably damaging Het
Pcsk1 T C 13: 75,132,119 S688P probably benign Het
Polr1a T C 6: 71,967,916 F1319L probably benign Het
Ppig T C 2: 69,749,459 Y446H unknown Het
Stk17b T C 1: 53,762,599 T88A probably benign Het
Tas2r143 A T 6: 42,400,265 I10F probably benign Het
Theg G A 10: 79,583,850 T182M probably damaging Het
Tmprss12 G A 15: 100,285,200 R141Q probably benign Het
Trpa1 A G 1: 14,891,303 probably null Het
Txndc16 A G 14: 45,172,563 S187P possibly damaging Het
Vmn2r98 T C 17: 19,080,749 I671T possibly damaging Het
Zfp78 G T 7: 6,378,661 V237F probably damaging Het
Other mutations in Ggt7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Ggt7 APN 2 155500771 missense probably damaging 0.99
IGL02523:Ggt7 APN 2 155514703 missense probably damaging 1.00
IGL02999:Ggt7 APN 2 155502713 missense probably benign 0.00
R0030:Ggt7 UTSW 2 155506488 missense probably benign 0.00
R0038:Ggt7 UTSW 2 155502781 missense probably benign 0.08
R0106:Ggt7 UTSW 2 155494893 missense possibly damaging 0.63
R0106:Ggt7 UTSW 2 155494893 missense possibly damaging 0.63
R0683:Ggt7 UTSW 2 155506508 missense probably benign 0.08
R1500:Ggt7 UTSW 2 155499046 missense probably benign 0.00
R1633:Ggt7 UTSW 2 155502688 missense probably damaging 1.00
R1693:Ggt7 UTSW 2 155506475 missense probably damaging 0.99
R1696:Ggt7 UTSW 2 155494979 missense possibly damaging 0.89
R1879:Ggt7 UTSW 2 155514787 missense possibly damaging 0.91
R2219:Ggt7 UTSW 2 155495719 missense probably damaging 1.00
R2220:Ggt7 UTSW 2 155495719 missense probably damaging 1.00
R4010:Ggt7 UTSW 2 155500732 missense probably benign 0.00
R5602:Ggt7 UTSW 2 155490999 missense possibly damaging 0.82
R5680:Ggt7 UTSW 2 155506433 missense probably damaging 1.00
R6092:Ggt7 UTSW 2 155518039 critical splice donor site probably null
R6440:Ggt7 UTSW 2 155498811 missense probably damaging 1.00
R6989:Ggt7 UTSW 2 155503460 missense probably benign 0.25
R7050:Ggt7 UTSW 2 155506375 missense probably benign 0.10
R7058:Ggt7 UTSW 2 155503095 splice site probably null
R7395:Ggt7 UTSW 2 155495880 missense probably benign 0.26
R7768:Ggt7 UTSW 2 155506501 missense possibly damaging 0.60
R7946:Ggt7 UTSW 2 155505972 missense probably damaging 0.98
X0065:Ggt7 UTSW 2 155495695 missense probably benign 0.37
Z1176:Ggt7 UTSW 2 155491078 missense probably damaging 0.99
Z1176:Ggt7 UTSW 2 155499063 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCACCCTGCTGGAAGATCTAAG -3'
(R):5'- TATTCTCAGCCTGGAGAGCCAGAC -3'

Sequencing Primer
(F):5'- CTGCTGGAAGATCTAAGAGCAAG -3'
(R):5'- TATTTGCCAGAGGCAGAAATCC -3'
Posted On2014-01-05