Incidental Mutation 'R1035:Cbln4'
ID95509
Institutional Source Beutler Lab
Gene Symbol Cbln4
Ensembl Gene ENSMUSG00000067578
Gene Namecerebellin 4 precursor protein
Synonyms
MMRRC Submission 039134-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.274) question?
Stock #R1035 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location172036233-172043466 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 172042069 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 77 (N77S)
Ref Sequence ENSEMBL: ENSMUSP00000085263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087950]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087950
AA Change: N77S

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000085263
Gene: ENSMUSG00000067578
AA Change: N77S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 49 60 N/A INTRINSIC
C1Q 61 198 1.14e-46 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137886
Meta Mutation Damage Score 0.1139 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.4%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of small secreted proteins containing C1Q domains. Members of this family are involved in regulation of neurexin signalling during synapse development. The mouse homolog of the protein encoded by this gene competes with netrin to bind to the deleted in colorectal cancer receptor. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Ap3b2 A T 7: 81,463,911 L850Q unknown Het
Asxl3 T C 18: 22,525,049 S2039P probably damaging Het
Cadm2 A T 16: 66,815,347 M109K probably damaging Het
Caskin1 A G 17: 24,505,037 N933S probably damaging Het
Chek1 A G 9: 36,716,473 I256T probably damaging Het
Col5a3 A T 9: 20,793,499 probably benign Het
Cyp2b10 C T 7: 25,917,048 S360L probably benign Het
Dctn1 T C 6: 83,190,220 S222P probably damaging Het
Dnah7b A G 1: 46,124,448 I471V probably benign Het
Ear2 A T 14: 44,102,887 M1L possibly damaging Het
Entpd6 T A 2: 150,764,192 probably benign Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fam98b C T 2: 117,270,639 R311W possibly damaging Het
Ggt7 A T 2: 155,506,427 C102S probably damaging Het
Myo15 T C 11: 60,510,558 probably benign Het
Nlrp9c C T 7: 26,371,277 probably benign Het
Nrxn1 A T 17: 90,163,874 N1234K probably damaging Het
Olfr201 C T 16: 59,268,944 C241Y probably damaging Het
Pcsk1 T C 13: 75,132,119 S688P probably benign Het
Polr1a T C 6: 71,967,916 F1319L probably benign Het
Ppig T C 2: 69,749,459 Y446H unknown Het
Stk17b T C 1: 53,762,599 T88A probably benign Het
Tas2r143 A T 6: 42,400,265 I10F probably benign Het
Theg G A 10: 79,583,850 T182M probably damaging Het
Tmprss12 G A 15: 100,285,200 R141Q probably benign Het
Trpa1 A G 1: 14,891,303 probably null Het
Txndc16 A G 14: 45,172,563 S187P possibly damaging Het
Vmn2r98 T C 17: 19,080,749 I671T possibly damaging Het
Zfp78 G T 7: 6,378,661 V237F probably damaging Het
Other mutations in Cbln4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Cbln4 APN 2 172039050 missense probably benign 0.44
IGL02156:Cbln4 APN 2 172042208 missense probably benign 0.24
R1352:Cbln4 UTSW 2 172037456 missense possibly damaging 0.89
R3031:Cbln4 UTSW 2 172042180 missense probably damaging 0.99
R4013:Cbln4 UTSW 2 172037557 missense probably damaging 0.98
R4881:Cbln4 UTSW 2 172042139 missense possibly damaging 0.78
R4934:Cbln4 UTSW 2 172038981 missense probably damaging 1.00
R6084:Cbln4 UTSW 2 172042096 missense probably damaging 1.00
R7138:Cbln4 UTSW 2 172042175 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTATTCCCTTCAGCCCCTGATGAC -3'
(R):5'- CCAGCCGTTCTGCTGATTCTAGTG -3'

Sequencing Primer
(F):5'- GCAGCTCTGAGTTTCAAACTG -3'
(R):5'- TGCTGATTCTAGTGCTGCC -3'
Posted On2014-01-05