Incidental Mutation 'R1120:Ubb'
ID95530
Institutional Source Beutler Lab
Gene Symbol Ubb
Ensembl Gene ENSMUSG00000019505
Gene Nameubiquitin B
SynonymsUbb2
MMRRC Submission 039193-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.313) question?
Stock #R1120 (G1)
Quality Score124
Status Not validated
Chromosome11
Chromosomal Location62551171-62553213 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62552183 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 13 (I13T)
Ref Sequence ENSEMBL: ENSMUSP00000019649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019649] [ENSMUST00000136938]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019649
AA Change: I13T

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000019649
Gene: ENSMUSG00000019505
AA Change: I13T

DomainStartEndE-ValueType
UBQ 1 72 2.14e-36 SMART
UBQ 77 148 2.14e-36 SMART
UBQ 153 224 2.14e-36 SMART
UBQ 229 300 2.14e-36 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000136938
AA Change: I13T

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117361
Gene: ENSMUSG00000019505
AA Change: I13T

DomainStartEndE-ValueType
UBQ 1 72 2.14e-36 SMART
UBQ 77 148 2.14e-36 SMART
UBQ 153 224 2.14e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142533
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: This gene encodes ubiquitin, one of the most conserved proteins known. Ubiquitin has a major role in targeting cellular proteins for degradation by the 26S proteosome. It is also involved in the maintenance of chromatin structure, the regulation of gene expression, and the stress response. Ubiquitin is synthesized as a precursor protein consisting of either polyubiquitin chains or a single ubiquitin moiety fused to an unrelated protein. This gene consists of four direct repeats of the ubiquitin coding sequence with no spacer sequence. Consequently, the protein is expressed as a polyubiquitin precursor with a final amino acid after the last repeat. Pseudogenes of this gene are located on chromosomes 3 and 14. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Targeted disruption of this gene results in progressive degeneration of hypothalamic neurons accompanied by impaired hypothalamic control of energy balance and adult-onset obesity. Both genders are infertile due to a failure of germ cells to progress through meiosis I and hypogonadism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T G 5: 24,408,820 probably null Het
Akp3 A T 1: 87,125,437 Q77L probably damaging Het
Blm A G 7: 80,481,466 L878S probably damaging Het
Cabin1 A G 10: 75,725,716 Y984H probably damaging Het
Cadps2 T C 6: 23,838,794 Q86R probably damaging Het
Cd2 C T 3: 101,287,488 D95N probably damaging Het
Cd36 A G 5: 17,785,828 I438T possibly damaging Het
Crhbp G T 13: 95,442,085 T176K probably benign Het
D630045J12Rik G T 6: 38,194,770 T821K probably damaging Het
Disp1 T C 1: 183,098,575 D288G probably benign Het
Dsc3 A G 18: 19,986,977 V208A probably benign Het
Eef1e1 A T 13: 38,658,934 N20K probably damaging Het
Ercc5 A G 1: 44,161,841 D187G probably damaging Het
Etl4 T A 2: 20,806,703 M1199K probably benign Het
Fnbp1 A T 2: 31,036,594 Y433N probably damaging Het
Fxyd3 A G 7: 31,071,378 probably benign Het
Hfm1 A T 5: 106,904,218 probably benign Het
Irak2 T A 6: 113,675,759 probably benign Het
Jpt2 T C 17: 24,960,611 M1V probably null Het
Knl1 A G 2: 119,062,375 R51G probably damaging Het
Krtap8-1 A G 16: 89,487,865 Y15H probably benign Het
Lrba A T 3: 86,295,192 D250V probably damaging Het
Mgat4a A G 1: 37,452,581 S357P probably damaging Het
Nup98 T A 7: 102,160,716 T536S probably damaging Het
Olfr1197 A G 2: 88,728,937 Y221H probably damaging Het
Olfr1214 A G 2: 88,988,079 M41T possibly damaging Het
Olfr825 A G 10: 130,162,537 L263P probably damaging Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pnpla8 A G 12: 44,304,947 T568A possibly damaging Het
Ptprn A G 1: 75,258,181 I254T probably benign Het
Rab5b A C 10: 128,679,614 N188K probably benign Het
Samd5 A G 10: 9,629,048 V154A possibly damaging Het
Smarcb1 A G 10: 75,921,323 F25L probably benign Het
Smchd1 A T 17: 71,358,146 Y1847* probably null Het
Smpd4 T C 16: 17,638,486 probably benign Het
Tex14 T A 11: 87,538,676 probably benign Het
Tnfrsf26 G A 7: 143,617,914 R101C probably damaging Het
Trmu A G 15: 85,890,285 K37E possibly damaging Het
Tsen54 C T 11: 115,815,013 A52V probably damaging Het
Vmn2r101 A T 17: 19,577,461 probably benign Het
Other mutations in Ubb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03302:Ubb APN 11 62552417 missense probably damaging 1.00
BB009:Ubb UTSW 11 62552785 nonsense probably null
BB019:Ubb UTSW 11 62552785 nonsense probably null
R6223:Ubb UTSW 11 62552525 missense possibly damaging 0.91
R6753:Ubb UTSW 11 62551527 splice site probably null
R7932:Ubb UTSW 11 62552785 nonsense probably null
R8201:Ubb UTSW 11 62552227 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGATGCCCCGCAGTTGATGAATG -3'
(R):5'- ATGGTCTTGCCAGTCAGGGTCTTC -3'

Sequencing Primer
(F):5'- TGTTCCAAATGCCAGTTTAGTG -3'
(R):5'- ACCTCTCAGGCGAAGGAC -3'
Posted On2014-01-05