Incidental Mutation 'R1035:Zfp78'
ID95531
Institutional Source Beutler Lab
Gene Symbol Zfp78
Ensembl Gene ENSMUSG00000055150
Gene Namezinc finger protein 78
SynonymsKRAB12, Zfp77
MMRRC Submission 039134-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R1035 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location6363280-6382605 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 6378661 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 237 (V237F)
Ref Sequence ENSEMBL: ENSMUSP00000147154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081022] [ENSMUST00000086323] [ENSMUST00000108559] [ENSMUST00000207314] [ENSMUST00000207347] [ENSMUST00000208030] [ENSMUST00000208390] [ENSMUST00000208763]
Predicted Effect probably benign
Transcript: ENSMUST00000081022
SMART Domains Protein: ENSMUSP00000079812
Gene: ENSMUSG00000062861

DomainStartEndE-ValueType
low complexity region 27 50 N/A INTRINSIC
KRAB 103 163 3.53e-33 SMART
ZnF_C2H2 377 399 3.95e-4 SMART
ZnF_C2H2 405 427 6.88e-4 SMART
ZnF_C2H2 433 456 1.2e-3 SMART
ZnF_C2H2 462 484 9.58e-3 SMART
ZnF_C2H2 490 512 2.57e-3 SMART
ZnF_C2H2 518 540 1.82e-3 SMART
ZnF_C2H2 546 568 2.4e-3 SMART
ZnF_C2H2 574 596 6.32e-3 SMART
ZnF_C2H2 602 624 1.38e-3 SMART
ZnF_C2H2 630 652 4.87e-4 SMART
ZnF_C2H2 658 680 2.91e-2 SMART
ZnF_C2H2 686 708 2.36e-2 SMART
ZnF_C2H2 714 736 6.42e-4 SMART
ZnF_C2H2 742 764 2.4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086323
AA Change: V205F

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000083503
Gene: ENSMUSG00000055150
AA Change: V205F

DomainStartEndE-ValueType
KRAB 14 74 1.07e-23 SMART
low complexity region 148 159 N/A INTRINSIC
ZnF_C2H2 173 195 3.39e-3 SMART
ZnF_C2H2 201 223 2.36e-2 SMART
ZnF_C2H2 229 251 3.63e-3 SMART
ZnF_C2H2 257 279 3.89e-3 SMART
ZnF_C2H2 285 307 3.95e-4 SMART
ZnF_C2H2 313 335 1.69e-3 SMART
ZnF_C2H2 341 363 5.21e-4 SMART
ZnF_C2H2 369 391 1.38e-3 SMART
ZnF_C2H2 397 419 9.88e-5 SMART
ZnF_C2H2 425 447 7.67e-2 SMART
ZnF_C2H2 453 475 6.32e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108559
AA Change: V237F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104199
Gene: ENSMUSG00000055150
AA Change: V237F

DomainStartEndE-ValueType
KRAB 14 74 3.12e-34 SMART
low complexity region 180 191 N/A INTRINSIC
ZnF_C2H2 205 227 3.39e-3 SMART
ZnF_C2H2 233 255 2.36e-2 SMART
ZnF_C2H2 261 283 3.63e-3 SMART
ZnF_C2H2 289 311 3.89e-3 SMART
ZnF_C2H2 317 339 3.95e-4 SMART
ZnF_C2H2 345 367 1.69e-3 SMART
ZnF_C2H2 373 395 5.21e-4 SMART
ZnF_C2H2 401 423 1.38e-3 SMART
ZnF_C2H2 429 451 9.88e-5 SMART
ZnF_C2H2 457 479 7.67e-2 SMART
ZnF_C2H2 485 507 6.32e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207086
Predicted Effect probably benign
Transcript: ENSMUST00000207314
AA Change: V205F

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably damaging
Transcript: ENSMUST00000207347
AA Change: V237F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000208030
AA Change: V205F

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000208390
AA Change: V205F

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000208763
Predicted Effect probably benign
Transcript: ENSMUST00000208949
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.4%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Ap3b2 A T 7: 81,463,911 L850Q unknown Het
Asxl3 T C 18: 22,525,049 S2039P probably damaging Het
Cadm2 A T 16: 66,815,347 M109K probably damaging Het
Caskin1 A G 17: 24,505,037 N933S probably damaging Het
Cbln4 T C 2: 172,042,069 N77S possibly damaging Het
Chek1 A G 9: 36,716,473 I256T probably damaging Het
Col5a3 A T 9: 20,793,499 probably benign Het
Cyp2b10 C T 7: 25,917,048 S360L probably benign Het
Dctn1 T C 6: 83,190,220 S222P probably damaging Het
Dnah7b A G 1: 46,124,448 I471V probably benign Het
Ear2 A T 14: 44,102,887 M1L possibly damaging Het
Entpd6 T A 2: 150,764,192 probably benign Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fam98b C T 2: 117,270,639 R311W possibly damaging Het
Ggt7 A T 2: 155,506,427 C102S probably damaging Het
Myo15 T C 11: 60,510,558 probably benign Het
Nlrp9c C T 7: 26,371,277 probably benign Het
Nrxn1 A T 17: 90,163,874 N1234K probably damaging Het
Olfr201 C T 16: 59,268,944 C241Y probably damaging Het
Pcsk1 T C 13: 75,132,119 S688P probably benign Het
Polr1a T C 6: 71,967,916 F1319L probably benign Het
Ppig T C 2: 69,749,459 Y446H unknown Het
Stk17b T C 1: 53,762,599 T88A probably benign Het
Tas2r143 A T 6: 42,400,265 I10F probably benign Het
Theg G A 10: 79,583,850 T182M probably damaging Het
Tmprss12 G A 15: 100,285,200 R141Q probably benign Het
Trpa1 A G 1: 14,891,303 probably null Het
Txndc16 A G 14: 45,172,563 S187P possibly damaging Het
Vmn2r98 T C 17: 19,080,749 I671T possibly damaging Het
Other mutations in Zfp78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Zfp78 APN 7 6375588 missense possibly damaging 0.90
R0502:Zfp78 UTSW 7 6373158 missense probably damaging 1.00
R0704:Zfp78 UTSW 7 6379252 missense probably damaging 1.00
R1402:Zfp78 UTSW 7 6378619 missense probably damaging 1.00
R1402:Zfp78 UTSW 7 6378619 missense probably damaging 1.00
R1908:Zfp78 UTSW 7 6378898 missense probably damaging 0.97
R1955:Zfp78 UTSW 7 6378559 missense probably benign 0.00
R2004:Zfp78 UTSW 7 6379075 missense probably damaging 1.00
R2025:Zfp78 UTSW 7 6375514 splice site probably null
R2357:Zfp78 UTSW 7 6379057 missense probably damaging 1.00
R5503:Zfp78 UTSW 7 6378529 missense probably benign
R6742:Zfp78 UTSW 7 6378278 missense probably damaging 0.97
R6996:Zfp78 UTSW 7 6378765 missense probably benign 0.38
R7944:Zfp78 UTSW 7 6378590 missense possibly damaging 0.53
R7949:Zfp78 UTSW 7 6379366 missense possibly damaging 0.89
R8186:Zfp78 UTSW 7 6373229 missense probably damaging 1.00
R8272:Zfp78 UTSW 7 6373214 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCGAATCCTTAAAATCTGCCCATCTG -3'
(R):5'- AGGCCCTTCcacatttctcacatacata -3'

Sequencing Primer
(F):5'- gaaaatctgggcagggaaga -3'
(R):5'- gtcttcccacattcgttacattc -3'
Posted On2014-01-05