Incidental Mutation 'R1035:Nlrp9c'
ID95535
Institutional Source Beutler Lab
Gene Symbol Nlrp9c
Ensembl Gene ENSMUSG00000040614
Gene NameNLR family, pyrin domain containing 9C
SynonymsNalp9c, Nalp-zeta
MMRRC Submission 039134-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1035 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location26322473-26403700 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 26371277 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000083106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041845] [ENSMUST00000085944]
Predicted Effect probably benign
Transcript: ENSMUST00000041845
SMART Domains Protein: ENSMUSP00000036041
Gene: ENSMUSG00000040614

DomainStartEndE-ValueType
PYRIN 5 87 7.64e-22 SMART
Pfam:NACHT 143 310 5.2e-31 PFAM
LRR 637 664 4.36e1 SMART
Blast:LRR 666 691 3e-6 BLAST
LRR 693 720 1.02e0 SMART
LRR 722 749 3e0 SMART
LRR 750 777 6.88e-4 SMART
LRR 779 806 5.06e0 SMART
LRR 807 834 1.22e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000085944
SMART Domains Protein: ENSMUSP00000083106
Gene: ENSMUSG00000040614

DomainStartEndE-ValueType
PYRIN 5 87 7.64e-22 SMART
Pfam:NACHT 143 310 2.8e-31 PFAM
LRR 631 658 7.49e0 SMART
LRR 692 719 4.36e1 SMART
Blast:LRR 721 746 8e-6 BLAST
LRR 748 775 1.02e0 SMART
LRR 777 804 3e0 SMART
LRR 805 832 6.88e-4 SMART
LRR 834 861 2.17e0 SMART
LRR 862 889 2.12e-4 SMART
LRR 919 946 1.22e1 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.4%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Ap3b2 A T 7: 81,463,911 L850Q unknown Het
Asxl3 T C 18: 22,525,049 S2039P probably damaging Het
Cadm2 A T 16: 66,815,347 M109K probably damaging Het
Caskin1 A G 17: 24,505,037 N933S probably damaging Het
Cbln4 T C 2: 172,042,069 N77S possibly damaging Het
Chek1 A G 9: 36,716,473 I256T probably damaging Het
Col5a3 A T 9: 20,793,499 probably benign Het
Cyp2b10 C T 7: 25,917,048 S360L probably benign Het
Dctn1 T C 6: 83,190,220 S222P probably damaging Het
Dnah7b A G 1: 46,124,448 I471V probably benign Het
Ear2 A T 14: 44,102,887 M1L possibly damaging Het
Entpd6 T A 2: 150,764,192 probably benign Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fam98b C T 2: 117,270,639 R311W possibly damaging Het
Ggt7 A T 2: 155,506,427 C102S probably damaging Het
Myo15 T C 11: 60,510,558 probably benign Het
Nrxn1 A T 17: 90,163,874 N1234K probably damaging Het
Olfr201 C T 16: 59,268,944 C241Y probably damaging Het
Pcsk1 T C 13: 75,132,119 S688P probably benign Het
Polr1a T C 6: 71,967,916 F1319L probably benign Het
Ppig T C 2: 69,749,459 Y446H unknown Het
Stk17b T C 1: 53,762,599 T88A probably benign Het
Tas2r143 A T 6: 42,400,265 I10F probably benign Het
Theg G A 10: 79,583,850 T182M probably damaging Het
Tmprss12 G A 15: 100,285,200 R141Q probably benign Het
Trpa1 A G 1: 14,891,303 probably null Het
Txndc16 A G 14: 45,172,563 S187P possibly damaging Het
Vmn2r98 T C 17: 19,080,749 I671T possibly damaging Het
Zfp78 G T 7: 6,378,661 V237F probably damaging Het
Other mutations in Nlrp9c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Nlrp9c APN 7 26384588 missense probably benign 0.00
IGL00814:Nlrp9c APN 7 26384750 missense probably benign 0.23
IGL00919:Nlrp9c APN 7 26394056 nonsense probably null
IGL01762:Nlrp9c APN 7 26385425 missense probably damaging 1.00
IGL01928:Nlrp9c APN 7 26375422 splice site probably benign
IGL02008:Nlrp9c APN 7 26385151 missense probably benign 0.16
IGL02389:Nlrp9c APN 7 26394207 missense probably benign
IGL02535:Nlrp9c APN 7 26372097 missense probably damaging 1.00
IGL02685:Nlrp9c APN 7 26385557 missense probably damaging 0.98
IGL02904:Nlrp9c APN 7 26375290 missense probably damaging 1.00
IGL02935:Nlrp9c APN 7 26385276 missense probably benign 0.00
IGL03006:Nlrp9c APN 7 26372082 missense probably damaging 0.98
IGL03140:Nlrp9c APN 7 26380489 missense probably benign 0.30
IGL03201:Nlrp9c APN 7 26385108 missense probably benign 0.00
IGL03243:Nlrp9c APN 7 26365032 missense probably damaging 0.99
IGL03054:Nlrp9c UTSW 7 26382276 splice site probably null
K7894:Nlrp9c UTSW 7 26384898 missense possibly damaging 0.94
R0018:Nlrp9c UTSW 7 26371998 missense possibly damaging 0.89
R0018:Nlrp9c UTSW 7 26371998 missense possibly damaging 0.89
R0238:Nlrp9c UTSW 7 26378012 missense possibly damaging 0.90
R0238:Nlrp9c UTSW 7 26378012 missense possibly damaging 0.90
R0335:Nlrp9c UTSW 7 26394136 missense possibly damaging 0.92
R0391:Nlrp9c UTSW 7 26371476 splice site probably benign
R0433:Nlrp9c UTSW 7 26385819 missense probably benign 0.20
R1118:Nlrp9c UTSW 7 26384437 missense probably benign 0.01
R1119:Nlrp9c UTSW 7 26384437 missense probably benign 0.01
R1173:Nlrp9c UTSW 7 26380435 missense probably damaging 1.00
R1519:Nlrp9c UTSW 7 26378101 missense possibly damaging 0.88
R1528:Nlrp9c UTSW 7 26382298 missense probably damaging 0.99
R1616:Nlrp9c UTSW 7 26384437 missense probably benign 0.01
R1774:Nlrp9c UTSW 7 26394118 missense probably benign 0.05
R1789:Nlrp9c UTSW 7 26380490 missense probably benign 0.00
R1869:Nlrp9c UTSW 7 26384820 nonsense probably null
R1870:Nlrp9c UTSW 7 26384820 nonsense probably null
R1920:Nlrp9c UTSW 7 26384894 missense probably damaging 1.00
R1987:Nlrp9c UTSW 7 26378056 missense probably benign 0.31
R2022:Nlrp9c UTSW 7 26384796 missense probably damaging 1.00
R2309:Nlrp9c UTSW 7 26378087 missense probably damaging 1.00
R2327:Nlrp9c UTSW 7 26375322 missense probably damaging 1.00
R3405:Nlrp9c UTSW 7 26385282 missense probably benign 0.01
R3548:Nlrp9c UTSW 7 26371451 missense probably damaging 1.00
R3846:Nlrp9c UTSW 7 26382276 splice site probably null
R4179:Nlrp9c UTSW 7 26384661 missense possibly damaging 0.74
R4460:Nlrp9c UTSW 7 26378098 missense probably damaging 1.00
R4669:Nlrp9c UTSW 7 26375368 missense possibly damaging 0.90
R4708:Nlrp9c UTSW 7 26384840 missense probably benign 0.07
R4810:Nlrp9c UTSW 7 26378177 splice site probably null
R4824:Nlrp9c UTSW 7 26380564 missense possibly damaging 0.49
R4915:Nlrp9c UTSW 7 26384460 missense probably benign 0.34
R4996:Nlrp9c UTSW 7 26385747 missense possibly damaging 0.92
R5468:Nlrp9c UTSW 7 26365000 missense probably benign 0.00
R5525:Nlrp9c UTSW 7 26384501 missense probably damaging 1.00
R5526:Nlrp9c UTSW 7 26382366 missense possibly damaging 0.95
R6020:Nlrp9c UTSW 7 26384725 missense probably benign 0.08
R6175:Nlrp9c UTSW 7 26378001 splice site probably null
R6454:Nlrp9c UTSW 7 26385774 missense possibly damaging 0.91
R6493:Nlrp9c UTSW 7 26382387 missense probably damaging 1.00
R6649:Nlrp9c UTSW 7 26371322 missense probably damaging 1.00
R6653:Nlrp9c UTSW 7 26371322 missense probably damaging 1.00
R6739:Nlrp9c UTSW 7 26385425 missense probably damaging 0.99
R6883:Nlrp9c UTSW 7 26378131 missense probably benign 0.18
R7097:Nlrp9c UTSW 7 26385621 missense probably damaging 1.00
R7122:Nlrp9c UTSW 7 26385621 missense probably damaging 1.00
R7174:Nlrp9c UTSW 7 26385297 missense probably benign 0.03
R7365:Nlrp9c UTSW 7 26371397 missense possibly damaging 0.93
R7378:Nlrp9c UTSW 7 26365015 missense probably benign 0.14
R7427:Nlrp9c UTSW 7 26371435 missense probably benign 0.00
R7450:Nlrp9c UTSW 7 26364939 missense probably benign 0.45
R7999:Nlrp9c UTSW 7 26385489 missense possibly damaging 0.94
R8036:Nlrp9c UTSW 7 26371439 missense possibly damaging 0.49
R8056:Nlrp9c UTSW 7 26385687 missense probably damaging 1.00
R8249:Nlrp9c UTSW 7 26375353 nonsense probably null
RF020:Nlrp9c UTSW 7 26385224 missense probably benign
X0065:Nlrp9c UTSW 7 26380430 missense probably damaging 0.99
Z1177:Nlrp9c UTSW 7 26382348 missense probably benign 0.28
Z1177:Nlrp9c UTSW 7 26384775 missense probably damaging 1.00
Z1177:Nlrp9c UTSW 7 26384825 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- TCCATGCTTTAGAACAGAATGGCAACT -3'
(R):5'- ACTGGCACTGAACGACACAATCTT -3'

Sequencing Primer
(F):5'- TGTTAACGTGTGACAGTGGG -3'
(R):5'- ATATTCCTGCTCACAGGTTAGAC -3'
Posted On2014-01-05