Incidental Mutation 'R1035:Ap3b2'
ID95537
Institutional Source Beutler Lab
Gene Symbol Ap3b2
Ensembl Gene ENSMUSG00000062444
Gene Nameadaptor-related protein complex 3, beta 2 subunit
Synonymsbeta3B, Naptb
MMRRC Submission 039134-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R1035 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location81460399-81493925 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 81463911 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 850 (L850Q)
Ref Sequence ENSEMBL: ENSMUSP00000080739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082090]
Predicted Effect unknown
Transcript: ENSMUST00000082090
AA Change: L850Q
SMART Domains Protein: ENSMUSP00000080739
Gene: ENSMUSG00000062444
AA Change: L850Q

DomainStartEndE-ValueType
Pfam:Adaptin_N 34 590 8.2e-182 PFAM
low complexity region 689 782 N/A INTRINSIC
AP3B1_C 801 947 4.58e-75 SMART
Blast:B2 971 1080 2e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147624
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.4%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption does not alter pigmentation, but causes hyperactivity and tonic-clonic seizures and mice homozygous for a knock-out allele were found to have significantly reduced synaptic zinc levels throughout the brain, with the largest reduction observed in the CA1 stratum oriens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Asxl3 T C 18: 22,525,049 S2039P probably damaging Het
Cadm2 A T 16: 66,815,347 M109K probably damaging Het
Caskin1 A G 17: 24,505,037 N933S probably damaging Het
Cbln4 T C 2: 172,042,069 N77S possibly damaging Het
Chek1 A G 9: 36,716,473 I256T probably damaging Het
Col5a3 A T 9: 20,793,499 probably benign Het
Cyp2b10 C T 7: 25,917,048 S360L probably benign Het
Dctn1 T C 6: 83,190,220 S222P probably damaging Het
Dnah7b A G 1: 46,124,448 I471V probably benign Het
Ear2 A T 14: 44,102,887 M1L possibly damaging Het
Entpd6 T A 2: 150,764,192 probably benign Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fam98b C T 2: 117,270,639 R311W possibly damaging Het
Ggt7 A T 2: 155,506,427 C102S probably damaging Het
Myo15 T C 11: 60,510,558 probably benign Het
Nlrp9c C T 7: 26,371,277 probably benign Het
Nrxn1 A T 17: 90,163,874 N1234K probably damaging Het
Olfr201 C T 16: 59,268,944 C241Y probably damaging Het
Pcsk1 T C 13: 75,132,119 S688P probably benign Het
Polr1a T C 6: 71,967,916 F1319L probably benign Het
Ppig T C 2: 69,749,459 Y446H unknown Het
Stk17b T C 1: 53,762,599 T88A probably benign Het
Tas2r143 A T 6: 42,400,265 I10F probably benign Het
Theg G A 10: 79,583,850 T182M probably damaging Het
Tmprss12 G A 15: 100,285,200 R141Q probably benign Het
Trpa1 A G 1: 14,891,303 probably null Het
Txndc16 A G 14: 45,172,563 S187P possibly damaging Het
Vmn2r98 T C 17: 19,080,749 I671T possibly damaging Het
Zfp78 G T 7: 6,378,661 V237F probably damaging Het
Other mutations in Ap3b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Ap3b2 APN 7 81471949 missense probably damaging 0.98
IGL01695:Ap3b2 APN 7 81476939 splice site probably benign
IGL01876:Ap3b2 APN 7 81473854 splice site probably null
IGL02132:Ap3b2 APN 7 81460998 missense unknown
IGL02227:Ap3b2 APN 7 81473404 missense probably damaging 1.00
IGL02660:Ap3b2 APN 7 81465698 missense probably benign 0.13
R0045:Ap3b2 UTSW 7 81466193 missense possibly damaging 0.82
R0045:Ap3b2 UTSW 7 81466193 missense possibly damaging 0.82
R0142:Ap3b2 UTSW 7 81473080 missense probably damaging 0.96
R0317:Ap3b2 UTSW 7 81463681 splice site probably null
R0568:Ap3b2 UTSW 7 81464629 critical splice donor site probably null
R1121:Ap3b2 UTSW 7 81464195 missense unknown
R1160:Ap3b2 UTSW 7 81466169 critical splice donor site probably null
R1489:Ap3b2 UTSW 7 81463690 nonsense probably null
R1542:Ap3b2 UTSW 7 81478077 splice site probably null
R1652:Ap3b2 UTSW 7 81473399 missense probably damaging 1.00
R1741:Ap3b2 UTSW 7 81467599 missense possibly damaging 0.95
R1872:Ap3b2 UTSW 7 81464150 missense unknown
R2065:Ap3b2 UTSW 7 81463774 missense unknown
R2353:Ap3b2 UTSW 7 81473850 unclassified probably benign
R2354:Ap3b2 UTSW 7 81473850 unclassified probably benign
R2398:Ap3b2 UTSW 7 81477195 missense probably damaging 0.99
R3421:Ap3b2 UTSW 7 81473850 unclassified probably benign
R3710:Ap3b2 UTSW 7 81473850 unclassified probably benign
R3932:Ap3b2 UTSW 7 81473850 unclassified probably benign
R3933:Ap3b2 UTSW 7 81473850 unclassified probably benign
R4152:Ap3b2 UTSW 7 81478017 missense probably damaging 1.00
R4209:Ap3b2 UTSW 7 81477136 missense probably benign 0.02
R4732:Ap3b2 UTSW 7 81471932 missense probably damaging 1.00
R4733:Ap3b2 UTSW 7 81471932 missense probably damaging 1.00
R4841:Ap3b2 UTSW 7 81477930 missense probably damaging 1.00
R5207:Ap3b2 UTSW 7 81476769 missense possibly damaging 0.48
R5659:Ap3b2 UTSW 7 81476752 missense probably damaging 0.98
R6109:Ap3b2 UTSW 7 81493592 missense possibly damaging 0.55
R6223:Ap3b2 UTSW 7 81473462 nonsense probably null
R6901:Ap3b2 UTSW 7 81484912 critical splice acceptor site probably null
R6981:Ap3b2 UTSW 7 81477993 missense probably damaging 1.00
R7061:Ap3b2 UTSW 7 81461009 missense unknown
R7317:Ap3b2 UTSW 7 81461028 missense unknown
R7501:Ap3b2 UTSW 7 81473446 missense probably damaging 0.99
R7543:Ap3b2 UTSW 7 81466146 splice site probably null
R7643:Ap3b2 UTSW 7 81477072 missense probably benign 0.24
R7707:Ap3b2 UTSW 7 81476782 missense possibly damaging 0.60
R8111:Ap3b2 UTSW 7 81463782 missense unknown
R8273:Ap3b2 UTSW 7 81463242 missense unknown
X0013:Ap3b2 UTSW 7 81463240 critical splice donor site probably null
X0028:Ap3b2 UTSW 7 81463764 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTTTCCTTACAGCAAGGCCCC -3'
(R):5'- TGACACTCACAGACTCCTCTCTGG -3'

Sequencing Primer
(F):5'- TTTGATCCCAAGAGGGTATCAGC -3'
(R):5'- CTCTCTGGTGCCTTCGGTG -3'
Posted On2014-01-05