Incidental Mutation 'R1035:Col5a3'
ID 95541
Institutional Source Beutler Lab
Gene Symbol Col5a3
Ensembl Gene ENSMUSG00000004098
Gene Name collagen, type V, alpha 3
Synonyms Pro-alpha3(V)
MMRRC Submission 039134-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.398) question?
Stock # R1035 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 20681353-20726363 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 20704795 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000004201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004201]
AlphaFold Q9JLI2
Predicted Effect probably benign
Transcript: ENSMUST00000004201
SMART Domains Protein: ENSMUSP00000004201
Gene: ENSMUSG00000004098

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TSPN 32 211 7.08e-28 SMART
LamG 89 210 2.13e-2 SMART
low complexity region 247 267 N/A INTRINSIC
low complexity region 295 314 N/A INTRINSIC
low complexity region 341 347 N/A INTRINSIC
low complexity region 369 381 N/A INTRINSIC
low complexity region 391 434 N/A INTRINSIC
low complexity region 461 474 N/A INTRINSIC
Pfam:Collagen 475 538 5.5e-10 PFAM
low complexity region 597 616 N/A INTRINSIC
low complexity region 628 694 N/A INTRINSIC
internal_repeat_3 703 737 7.13e-16 PROSPERO
low complexity region 742 821 N/A INTRINSIC
low complexity region 823 844 N/A INTRINSIC
low complexity region 859 889 N/A INTRINSIC
internal_repeat_2 892 1081 5.05e-17 PROSPERO
internal_repeat_1 996 1133 7.47e-22 PROSPERO
internal_repeat_3 1105 1139 7.13e-16 PROSPERO
low complexity region 1140 1165 N/A INTRINSIC
low complexity region 1168 1255 N/A INTRINSIC
low complexity region 1258 1282 N/A INTRINSIC
low complexity region 1285 1306 N/A INTRINSIC
low complexity region 1311 1418 N/A INTRINSIC
Pfam:Collagen 1429 1491 9.5e-10 PFAM
COLFI 1508 1738 7.98e-92 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145974
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.4%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha chain for one of the low abundance fibrillar collagens. Fibrillar collagen molecules are trimers that can be composed of one or more types of alpha chains. Type V collagen is found in tissues containing type I collagen and appears to regulate the assembly of heterotypic fibers composed of both type I and type V collagen. This gene product is closely related to type XI collagen and it is possible that the collagen chains of types V and XI constitute a single collagen type with tissue-specific chain combinations. Mutations in this gene are thought to be responsible for the symptoms of a subset of patients with Ehlers-Danlos syndrome type III. Messages of several sizes can be detected in northern blots but sequence information cannot confirm the identity of the shorter messages. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation show decreased pancreatic beta cell mass, hyperglycemia, hypoinsulinemia, impaired glucose tolerance, insulin resistance and impaired glucose uptake. Homozygous females show decreased susceptibility to diet-induced obesity and a thin hypodermal fat layer. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 77,024,130 (GRCm39) T174M probably damaging Het
Ap3b2 A T 7: 81,113,659 (GRCm39) L850Q unknown Het
Asxl3 T C 18: 22,658,106 (GRCm39) S2039P probably damaging Het
Cadm2 A T 16: 66,612,235 (GRCm39) M109K probably damaging Het
Caskin1 A G 17: 24,724,011 (GRCm39) N933S probably damaging Het
Cbln4 T C 2: 171,883,989 (GRCm39) N77S possibly damaging Het
Chek1 A G 9: 36,627,769 (GRCm39) I256T probably damaging Het
Cyp2b10 C T 7: 25,616,473 (GRCm39) S360L probably benign Het
Dctn1 T C 6: 83,167,202 (GRCm39) S222P probably damaging Het
Dnah7b A G 1: 46,163,608 (GRCm39) I471V probably benign Het
Ear2 A T 14: 44,340,344 (GRCm39) M1L possibly damaging Het
Entpd6 T A 2: 150,606,112 (GRCm39) probably benign Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,084,988 (GRCm39) probably benign Het
Fam98b C T 2: 117,101,120 (GRCm39) R311W possibly damaging Het
Ggt7 A T 2: 155,348,347 (GRCm39) C102S probably damaging Het
Myo15a T C 11: 60,401,384 (GRCm39) probably benign Het
Nlrp9c C T 7: 26,070,702 (GRCm39) probably benign Het
Nrxn1 A T 17: 90,471,302 (GRCm39) N1234K probably damaging Het
Or5ac19 C T 16: 59,089,307 (GRCm39) C241Y probably damaging Het
Pcsk1 T C 13: 75,280,238 (GRCm39) S688P probably benign Het
Polr1a T C 6: 71,944,900 (GRCm39) F1319L probably benign Het
Ppig T C 2: 69,579,803 (GRCm39) Y446H unknown Het
Spmap2 G A 10: 79,419,684 (GRCm39) T182M probably damaging Het
Stk17b T C 1: 53,801,758 (GRCm39) T88A probably benign Het
Tas2r143 A T 6: 42,377,199 (GRCm39) I10F probably benign Het
Tmprss12 G A 15: 100,183,081 (GRCm39) R141Q probably benign Het
Trpa1 A G 1: 14,961,527 (GRCm39) probably null Het
Txndc16 A G 14: 45,410,020 (GRCm39) S187P possibly damaging Het
Vmn2r98 T C 17: 19,301,011 (GRCm39) I671T possibly damaging Het
Zfp78 G T 7: 6,381,660 (GRCm39) V237F probably damaging Het
Other mutations in Col5a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Col5a3 APN 9 20,697,685 (GRCm39) nonsense probably null
IGL01548:Col5a3 APN 9 20,714,296 (GRCm39) splice site probably benign
IGL02164:Col5a3 APN 9 20,703,939 (GRCm39) critical splice donor site probably null
IGL02297:Col5a3 APN 9 20,683,450 (GRCm39) missense unknown
IGL02333:Col5a3 APN 9 20,710,602 (GRCm39) missense unknown
IGL02349:Col5a3 APN 9 20,683,657 (GRCm39) missense unknown
IGL02390:Col5a3 APN 9 20,688,292 (GRCm39) missense unknown
IGL02685:Col5a3 APN 9 20,683,501 (GRCm39) missense unknown
IGL02941:Col5a3 APN 9 20,715,962 (GRCm39) missense unknown
IGL03001:Col5a3 APN 9 20,719,040 (GRCm39) missense unknown
IGL03061:Col5a3 APN 9 20,708,868 (GRCm39) critical splice donor site probably null
IGL03102:Col5a3 APN 9 20,715,931 (GRCm39) critical splice donor site probably null
IGL03308:Col5a3 APN 9 20,719,675 (GRCm39) missense unknown
IGL03372:Col5a3 APN 9 20,686,624 (GRCm39) missense unknown
Guppy UTSW 9 20,690,329 (GRCm39) missense probably damaging 1.00
minifish UTSW 9 20,696,882 (GRCm39) missense probably damaging 0.99
R0002:Col5a3 UTSW 9 20,721,152 (GRCm39) critical splice acceptor site probably null
R0012:Col5a3 UTSW 9 20,688,404 (GRCm39) splice site probably benign
R0316:Col5a3 UTSW 9 20,686,621 (GRCm39) missense unknown
R0357:Col5a3 UTSW 9 20,719,064 (GRCm39) splice site probably benign
R0360:Col5a3 UTSW 9 20,683,762 (GRCm39) missense unknown
R0483:Col5a3 UTSW 9 20,693,777 (GRCm39) splice site probably null
R0485:Col5a3 UTSW 9 20,694,004 (GRCm39) missense probably damaging 0.99
R0627:Col5a3 UTSW 9 20,686,781 (GRCm39) missense unknown
R1051:Col5a3 UTSW 9 20,686,531 (GRCm39) missense unknown
R1295:Col5a3 UTSW 9 20,719,714 (GRCm39) missense unknown
R1438:Col5a3 UTSW 9 20,691,253 (GRCm39) missense probably damaging 0.99
R1622:Col5a3 UTSW 9 20,683,516 (GRCm39) missense unknown
R1668:Col5a3 UTSW 9 20,682,392 (GRCm39) missense unknown
R1680:Col5a3 UTSW 9 20,695,964 (GRCm39) critical splice donor site probably null
R2112:Col5a3 UTSW 9 20,721,073 (GRCm39) missense unknown
R2149:Col5a3 UTSW 9 20,682,566 (GRCm39) missense unknown
R2159:Col5a3 UTSW 9 20,682,606 (GRCm39) missense unknown
R2939:Col5a3 UTSW 9 20,706,954 (GRCm39) missense unknown
R3236:Col5a3 UTSW 9 20,718,949 (GRCm39) missense unknown
R3845:Col5a3 UTSW 9 20,719,673 (GRCm39) missense unknown
R4598:Col5a3 UTSW 9 20,685,855 (GRCm39) critical splice donor site probably null
R4599:Col5a3 UTSW 9 20,685,855 (GRCm39) critical splice donor site probably null
R4611:Col5a3 UTSW 9 20,726,192 (GRCm39) unclassified probably benign
R4713:Col5a3 UTSW 9 20,704,870 (GRCm39) missense unknown
R4723:Col5a3 UTSW 9 20,720,887 (GRCm39) missense unknown
R5209:Col5a3 UTSW 9 20,689,939 (GRCm39) intron probably benign
R5336:Col5a3 UTSW 9 20,710,597 (GRCm39) missense unknown
R5378:Col5a3 UTSW 9 20,708,872 (GRCm39) missense unknown
R5614:Col5a3 UTSW 9 20,694,772 (GRCm39) splice site probably benign
R5775:Col5a3 UTSW 9 20,712,368 (GRCm39) missense unknown
R5895:Col5a3 UTSW 9 20,683,738 (GRCm39) missense unknown
R6048:Col5a3 UTSW 9 20,718,915 (GRCm39) missense unknown
R6265:Col5a3 UTSW 9 20,705,060 (GRCm39) missense unknown
R6372:Col5a3 UTSW 9 20,696,882 (GRCm39) missense probably damaging 0.99
R6520:Col5a3 UTSW 9 20,685,348 (GRCm39) missense unknown
R6558:Col5a3 UTSW 9 20,690,329 (GRCm39) missense probably damaging 1.00
R6608:Col5a3 UTSW 9 20,685,315 (GRCm39) missense unknown
R6679:Col5a3 UTSW 9 20,690,329 (GRCm39) missense probably damaging 1.00
R6680:Col5a3 UTSW 9 20,690,329 (GRCm39) missense probably damaging 1.00
R6696:Col5a3 UTSW 9 20,690,329 (GRCm39) missense probably damaging 1.00
R6698:Col5a3 UTSW 9 20,690,329 (GRCm39) missense probably damaging 1.00
R6700:Col5a3 UTSW 9 20,690,329 (GRCm39) missense probably damaging 1.00
R6708:Col5a3 UTSW 9 20,686,331 (GRCm39) missense unknown
R6712:Col5a3 UTSW 9 20,690,329 (GRCm39) missense probably damaging 1.00
R6714:Col5a3 UTSW 9 20,690,329 (GRCm39) missense probably damaging 1.00
R6828:Col5a3 UTSW 9 20,709,748 (GRCm39) missense unknown
R7343:Col5a3 UTSW 9 20,705,242 (GRCm39) critical splice donor site probably null
R7431:Col5a3 UTSW 9 20,682,131 (GRCm39) makesense probably null
R7500:Col5a3 UTSW 9 20,711,585 (GRCm39) missense unknown
R7592:Col5a3 UTSW 9 20,708,689 (GRCm39) missense unknown
R7671:Col5a3 UTSW 9 20,686,382 (GRCm39) critical splice acceptor site probably null
R7957:Col5a3 UTSW 9 20,685,347 (GRCm39) missense unknown
R8510:Col5a3 UTSW 9 20,705,028 (GRCm39) missense unknown
R8979:Col5a3 UTSW 9 20,686,597 (GRCm39) missense unknown
R9050:Col5a3 UTSW 9 20,697,691 (GRCm39) missense probably damaging 1.00
R9052:Col5a3 UTSW 9 20,710,733 (GRCm39) missense unknown
R9072:Col5a3 UTSW 9 20,682,453 (GRCm39) missense unknown
R9341:Col5a3 UTSW 9 20,704,909 (GRCm39) missense unknown
R9343:Col5a3 UTSW 9 20,704,909 (GRCm39) missense unknown
R9529:Col5a3 UTSW 9 20,685,308 (GRCm39) critical splice donor site probably null
R9562:Col5a3 UTSW 9 20,714,429 (GRCm39) missense unknown
R9781:Col5a3 UTSW 9 20,721,272 (GRCm39) missense unknown
Z1177:Col5a3 UTSW 9 20,686,630 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- ACAGAGTCGCTGTGGGGATTAAAAC -3'
(R):5'- CTTTCCTGGCTTCAAGGGTGATGAG -3'

Sequencing Primer
(F):5'- tccagaatcccccagtgag -3'
(R):5'- CAGCTCCAGATGAGGACTGTG -3'
Posted On 2014-01-05