Incidental Mutation 'R1035:Chek1'
ID95543
Institutional Source Beutler Lab
Gene Symbol Chek1
Ensembl Gene ENSMUSG00000032113
Gene Namecheckpoint kinase 1
SynonymsChk1
MMRRC Submission 039134-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1035 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location36708482-36727065 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36716473 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 256 (I256T)
Ref Sequence ENSEMBL: ENSMUSP00000134388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034625] [ENSMUST00000172702] [ENSMUST00000173963]
Predicted Effect probably damaging
Transcript: ENSMUST00000034625
AA Change: I256T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034625
Gene: ENSMUSG00000032113
AA Change: I256T

DomainStartEndE-ValueType
S_TKc 9 265 4.79e-85 SMART
low complexity region 280 291 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172702
AA Change: I256T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134388
Gene: ENSMUSG00000032113
AA Change: I256T

DomainStartEndE-ValueType
S_TKc 9 265 4.79e-85 SMART
low complexity region 280 291 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173534
AA Change: I256T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134013
Gene: ENSMUSG00000032113
AA Change: I256T

DomainStartEndE-ValueType
S_TKc 9 265 4.79e-85 SMART
low complexity region 280 291 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173963
AA Change: I256T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134029
Gene: ENSMUSG00000032113
AA Change: I256T

DomainStartEndE-ValueType
S_TKc 9 265 4.79e-85 SMART
low complexity region 280 291 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174105
SMART Domains Protein: ENSMUSP00000134398
Gene: ENSMUSG00000032113

DomainStartEndE-ValueType
STYKc 1 99 4.6e-3 SMART
low complexity region 114 125 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174794
Meta Mutation Damage Score 0.4926 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.4%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Ser/Thr protein kinase family. It is required for checkpoint mediated cell cycle arrest in response to DNA damage or the presence of unreplicated DNA. This protein acts to integrate signals from ATM and ATR, two cell cycle proteins involved in DNA damage responses, that also associate with chromatin in meiotic prophase I. Phosphorylation of CDC25A protein phosphatase by this protein is required for cells to delay cell cycle progression in response to double-strand DNA breaks. Several alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality between E2.5 and E7.5, impaired cell cycle checkpoint function, increase in blastocyst apoptosis and lack of inner cell mass proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Ap3b2 A T 7: 81,463,911 L850Q unknown Het
Asxl3 T C 18: 22,525,049 S2039P probably damaging Het
Cadm2 A T 16: 66,815,347 M109K probably damaging Het
Caskin1 A G 17: 24,505,037 N933S probably damaging Het
Cbln4 T C 2: 172,042,069 N77S possibly damaging Het
Col5a3 A T 9: 20,793,499 probably benign Het
Cyp2b10 C T 7: 25,917,048 S360L probably benign Het
Dctn1 T C 6: 83,190,220 S222P probably damaging Het
Dnah7b A G 1: 46,124,448 I471V probably benign Het
Ear2 A T 14: 44,102,887 M1L possibly damaging Het
Entpd6 T A 2: 150,764,192 probably benign Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fam98b C T 2: 117,270,639 R311W possibly damaging Het
Ggt7 A T 2: 155,506,427 C102S probably damaging Het
Myo15 T C 11: 60,510,558 probably benign Het
Nlrp9c C T 7: 26,371,277 probably benign Het
Nrxn1 A T 17: 90,163,874 N1234K probably damaging Het
Olfr201 C T 16: 59,268,944 C241Y probably damaging Het
Pcsk1 T C 13: 75,132,119 S688P probably benign Het
Polr1a T C 6: 71,967,916 F1319L probably benign Het
Ppig T C 2: 69,749,459 Y446H unknown Het
Stk17b T C 1: 53,762,599 T88A probably benign Het
Tas2r143 A T 6: 42,400,265 I10F probably benign Het
Theg G A 10: 79,583,850 T182M probably damaging Het
Tmprss12 G A 15: 100,285,200 R141Q probably benign Het
Trpa1 A G 1: 14,891,303 probably null Het
Txndc16 A G 14: 45,172,563 S187P possibly damaging Het
Vmn2r98 T C 17: 19,080,749 I671T possibly damaging Het
Zfp78 G T 7: 6,378,661 V237F probably damaging Het
Other mutations in Chek1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Chek1 APN 9 36722599 splice site probably null
IGL01061:Chek1 APN 9 36714519 missense possibly damaging 0.70
IGL01322:Chek1 APN 9 36718421 nonsense probably null
IGL01627:Chek1 APN 9 36723895 missense probably damaging 1.00
IGL02379:Chek1 APN 9 36723946 missense probably benign 0.03
IGL03160:Chek1 APN 9 36722645 missense probably damaging 1.00
R0558:Chek1 UTSW 9 36712115 missense possibly damaging 0.72
R1466:Chek1 UTSW 9 36725857 missense probably damaging 1.00
R1466:Chek1 UTSW 9 36725857 missense probably damaging 1.00
R1606:Chek1 UTSW 9 36719524 missense probably damaging 1.00
R1627:Chek1 UTSW 9 36714441 missense probably benign
R2152:Chek1 UTSW 9 36723983 missense probably damaging 1.00
R2153:Chek1 UTSW 9 36723983 missense probably damaging 1.00
R2154:Chek1 UTSW 9 36723983 missense probably damaging 1.00
R2270:Chek1 UTSW 9 36719686 missense probably damaging 1.00
R4014:Chek1 UTSW 9 36722754 splice site probably benign
R5285:Chek1 UTSW 9 36714452 missense probably benign 0.00
R5458:Chek1 UTSW 9 36714429 missense probably benign 0.30
R5547:Chek1 UTSW 9 36712104 missense probably benign 0.02
R5819:Chek1 UTSW 9 36710405 missense probably benign 0.01
R5853:Chek1 UTSW 9 36713687 missense probably damaging 1.00
R6334:Chek1 UTSW 9 36714492 missense possibly damaging 0.59
R6353:Chek1 UTSW 9 36723959 missense probably benign 0.01
R7319:Chek1 UTSW 9 36722643 missense probably damaging 1.00
R8235:Chek1 UTSW 9 36719574 missense probably benign 0.00
R8380:Chek1 UTSW 9 36712112 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- CAAATGCTGCTGCTTCTGCTCAAG -3'
(R):5'- TTCCTAAGCTGGCCTCAAGCATTC -3'

Sequencing Primer
(F):5'- GCTTCTGCTCAAGTCAAATATGC -3'
(R):5'- cattctgcctgtgcctttc -3'
Posted On2014-01-05