Incidental Mutation 'R1035:Theg'
ID95549
Institutional Source Beutler Lab
Gene Symbol Theg
Ensembl Gene ENSMUSG00000020317
Gene Nametesticular haploid expressed gene
Synonyms
MMRRC Submission 039134-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1035 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location79576379-79587331 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 79583850 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 182 (T182M)
Ref Sequence ENSEMBL: ENSMUSP00000076647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020566] [ENSMUST00000077433]
Predicted Effect probably damaging
Transcript: ENSMUST00000020566
AA Change: T206M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020566
Gene: ENSMUSG00000020317
AA Change: T206M

DomainStartEndE-ValueType
THEG 9 28 1.68e2 SMART
low complexity region 58 73 N/A INTRINSIC
THEG 110 129 2.22e-2 SMART
THEG 176 195 4.69e-1 SMART
THEG 214 233 9.16e-4 SMART
THEG 250 269 7.22e-2 SMART
THEG 282 301 2.31e0 SMART
THEG 318 337 4.45e-2 SMART
THEG 352 371 1.96e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000077433
AA Change: T182M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076647
Gene: ENSMUSG00000020317
AA Change: T182M

DomainStartEndE-ValueType
THEG 9 28 6.2e-1 SMART
low complexity region 58 73 N/A INTRINSIC
THEG 110 129 7.8e-5 SMART
THEG 152 171 1.7e-3 SMART
THEG 190 209 3.3e-6 SMART
THEG 226 245 2.5e-4 SMART
THEG 258 277 8.3e-3 SMART
THEG 294 313 1.6e-4 SMART
THEG 328 347 7e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159782
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.4%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is specifically expressed in the nucleus of haploid male germ cells. The orthologous gene in mice encodes a protein that may play a role in protein assembly through interactions with T-complex protein 1 subunit epsilon. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Males homozygotes for a transgenic insertional mutation are sterile due to a block in spermiogenesis. Testis weights are reduced, and mutants exhibit multiple abnormalities in elongated spermatids in the seminiferous tubule lumen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Ap3b2 A T 7: 81,463,911 L850Q unknown Het
Asxl3 T C 18: 22,525,049 S2039P probably damaging Het
Cadm2 A T 16: 66,815,347 M109K probably damaging Het
Caskin1 A G 17: 24,505,037 N933S probably damaging Het
Cbln4 T C 2: 172,042,069 N77S possibly damaging Het
Chek1 A G 9: 36,716,473 I256T probably damaging Het
Col5a3 A T 9: 20,793,499 probably benign Het
Cyp2b10 C T 7: 25,917,048 S360L probably benign Het
Dctn1 T C 6: 83,190,220 S222P probably damaging Het
Dnah7b A G 1: 46,124,448 I471V probably benign Het
Ear2 A T 14: 44,102,887 M1L possibly damaging Het
Entpd6 T A 2: 150,764,192 probably benign Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fam98b C T 2: 117,270,639 R311W possibly damaging Het
Ggt7 A T 2: 155,506,427 C102S probably damaging Het
Myo15 T C 11: 60,510,558 probably benign Het
Nlrp9c C T 7: 26,371,277 probably benign Het
Nrxn1 A T 17: 90,163,874 N1234K probably damaging Het
Olfr201 C T 16: 59,268,944 C241Y probably damaging Het
Pcsk1 T C 13: 75,132,119 S688P probably benign Het
Polr1a T C 6: 71,967,916 F1319L probably benign Het
Ppig T C 2: 69,749,459 Y446H unknown Het
Stk17b T C 1: 53,762,599 T88A probably benign Het
Tas2r143 A T 6: 42,400,265 I10F probably benign Het
Tmprss12 G A 15: 100,285,200 R141Q probably benign Het
Trpa1 A G 1: 14,891,303 probably null Het
Txndc16 A G 14: 45,172,563 S187P possibly damaging Het
Vmn2r98 T C 17: 19,080,749 I671T possibly damaging Het
Zfp78 G T 7: 6,378,661 V237F probably damaging Het
Other mutations in Theg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Theg APN 10 79576599 missense probably damaging 0.99
IGL02013:Theg APN 10 79579935 splice site probably null
R0087:Theg UTSW 10 79585951 nonsense probably null
R4133:Theg UTSW 10 79580050 missense probably damaging 0.97
R5960:Theg UTSW 10 79585931 missense possibly damaging 0.76
R5971:Theg UTSW 10 79584755 missense probably damaging 1.00
R6067:Theg UTSW 10 79584755 missense probably damaging 1.00
R6138:Theg UTSW 10 79584755 missense probably damaging 1.00
R6357:Theg UTSW 10 79586955 missense probably benign 0.28
R7046:Theg UTSW 10 79586962 missense probably benign 0.35
R7117:Theg UTSW 10 79584907 splice site probably null
R7463:Theg UTSW 10 79576715 missense probably damaging 0.99
U15987:Theg UTSW 10 79584755 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCAGATGACCTAGTGAACCCCAC -3'
(R):5'- GCGGAGATAGCTCCCGATTTTACC -3'

Sequencing Primer
(F):5'- TCTCACCTGAATTTAAAGGCAGC -3'
(R):5'- AGGGTAGTCACTTCCCTAGC -3'
Posted On2014-01-05