Incidental Mutation 'R1035:Txndc16'
ID95561
Institutional Source Beutler Lab
Gene Symbol Txndc16
Ensembl Gene ENSMUSG00000021830
Gene Namethioredoxin domain containing 16
Synonyms5730420B22Rik
MMRRC Submission 039134-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R1035 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location45133465-45220328 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45172563 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 187 (S187P)
Ref Sequence ENSEMBL: ENSMUSP00000154077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022377] [ENSMUST00000123879] [ENSMUST00000128484] [ENSMUST00000139526] [ENSMUST00000147853]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022377
AA Change: S187P

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000022377
Gene: ENSMUSG00000021830
AA Change: S187P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 354 367 N/A INTRINSIC
Pfam:Thioredoxin 394 496 1.9e-12 PFAM
Pfam:Thioredoxin_6 534 723 2.3e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000123879
AA Change: S187P

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000123023
Gene: ENSMUSG00000021830
AA Change: S187P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 354 367 N/A INTRINSIC
Pfam:Thioredoxin 394 496 1.9e-12 PFAM
Pfam:Thioredoxin_6 534 723 2.3e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000128484
AA Change: S187P

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000139526
AA Change: S187P

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000120287
Gene: ENSMUSG00000021830
AA Change: S187P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 354 367 N/A INTRINSIC
Pfam:Thioredoxin 394 496 1e-12 PFAM
Pfam:Thioredoxin_6 534 723 7.3e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000147853
AA Change: S187P

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000156600
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.4%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Ap3b2 A T 7: 81,463,911 L850Q unknown Het
Asxl3 T C 18: 22,525,049 S2039P probably damaging Het
Cadm2 A T 16: 66,815,347 M109K probably damaging Het
Caskin1 A G 17: 24,505,037 N933S probably damaging Het
Cbln4 T C 2: 172,042,069 N77S possibly damaging Het
Chek1 A G 9: 36,716,473 I256T probably damaging Het
Col5a3 A T 9: 20,793,499 probably benign Het
Cyp2b10 C T 7: 25,917,048 S360L probably benign Het
Dctn1 T C 6: 83,190,220 S222P probably damaging Het
Dnah7b A G 1: 46,124,448 I471V probably benign Het
Ear2 A T 14: 44,102,887 M1L possibly damaging Het
Entpd6 T A 2: 150,764,192 probably benign Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fam98b C T 2: 117,270,639 R311W possibly damaging Het
Ggt7 A T 2: 155,506,427 C102S probably damaging Het
Myo15 T C 11: 60,510,558 probably benign Het
Nlrp9c C T 7: 26,371,277 probably benign Het
Nrxn1 A T 17: 90,163,874 N1234K probably damaging Het
Olfr201 C T 16: 59,268,944 C241Y probably damaging Het
Pcsk1 T C 13: 75,132,119 S688P probably benign Het
Polr1a T C 6: 71,967,916 F1319L probably benign Het
Ppig T C 2: 69,749,459 Y446H unknown Het
Stk17b T C 1: 53,762,599 T88A probably benign Het
Tas2r143 A T 6: 42,400,265 I10F probably benign Het
Theg G A 10: 79,583,850 T182M probably damaging Het
Tmprss12 G A 15: 100,285,200 R141Q probably benign Het
Trpa1 A G 1: 14,891,303 probably null Het
Vmn2r98 T C 17: 19,080,749 I671T possibly damaging Het
Zfp78 G T 7: 6,378,661 V237F probably damaging Het
Other mutations in Txndc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Txndc16 APN 14 45162350 missense probably damaging 0.99
IGL00427:Txndc16 APN 14 45145090 splice site probably benign
IGL02554:Txndc16 APN 14 45172538 missense probably damaging 1.00
IGL02666:Txndc16 APN 14 45211150 splice site probably benign
IGL02707:Txndc16 APN 14 45162273 missense probably benign
IGL03198:Txndc16 APN 14 45151484 splice site probably benign
IGL03256:Txndc16 APN 14 45151896 missense probably damaging 1.00
R0647:Txndc16 UTSW 14 45169275 missense probably damaging 1.00
R0647:Txndc16 UTSW 14 45165361 nonsense probably null
R0838:Txndc16 UTSW 14 45165419 splice site probably benign
R1116:Txndc16 UTSW 14 45162985 missense probably benign 0.06
R1511:Txndc16 UTSW 14 45151887 missense probably damaging 0.97
R2114:Txndc16 UTSW 14 45145027 missense probably benign 0.00
R2139:Txndc16 UTSW 14 45172589 missense probably damaging 1.00
R3784:Txndc16 UTSW 14 45165886 missense probably damaging 1.00
R3801:Txndc16 UTSW 14 45151352 missense possibly damaging 0.85
R5215:Txndc16 UTSW 14 45211140 intron probably benign
R5620:Txndc16 UTSW 14 45135878 missense possibly damaging 0.86
R5726:Txndc16 UTSW 14 45165764 missense probably benign 0.38
R6297:Txndc16 UTSW 14 45151786 missense probably benign 0.10
R6603:Txndc16 UTSW 14 45151767 missense probably damaging 0.99
R6626:Txndc16 UTSW 14 45161335 splice site probably null
R6876:Txndc16 UTSW 14 45163040 missense possibly damaging 0.55
R7102:Txndc16 UTSW 14 45205382 missense probably benign 0.00
R7166:Txndc16 UTSW 14 45183154 missense probably benign 0.22
R7465:Txndc16 UTSW 14 45165388 missense probably damaging 0.97
R7670:Txndc16 UTSW 14 45135867 nonsense probably null
R7684:Txndc16 UTSW 14 45147868 missense possibly damaging 0.83
R7783:Txndc16 UTSW 14 45144960 missense probably benign 0.02
R8316:Txndc16 UTSW 14 45211184 missense probably damaging 1.00
RF013:Txndc16 UTSW 14 45169338 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CCTTTAGCGAAACCCAAGCTCTGAC -3'
(R):5'- TGGCATTATCTCATGCTGGGATCATTG -3'

Sequencing Primer
(F):5'- CCCAAGCTCTGACAGTGAAG -3'
(R):5'- GCATGGAGTCACATGCTATTTCC -3'
Posted On2014-01-05