Incidental Mutation 'R1035:Tmprss12'
ID95565
Institutional Source Beutler Lab
Gene Symbol Tmprss12
Ensembl Gene ENSMUSG00000045631
Gene Nametransmembrane (C-terminal) protease, serine 12
Synonyms
MMRRC Submission 039134-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R1035 (G1)
Quality Score205
Status Validated
Chromosome15
Chromosomal Location100280837-100293066 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 100285200 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 141 (R141Q)
Ref Sequence ENSEMBL: ENSMUSP00000093914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096200]
Predicted Effect probably benign
Transcript: ENSMUST00000096200
AA Change: R141Q

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000093914
Gene: ENSMUSG00000045631
AA Change: R141Q

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Tryp_SPc 65 301 1.82e-77 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230901
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.4%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Ap3b2 A T 7: 81,463,911 L850Q unknown Het
Asxl3 T C 18: 22,525,049 S2039P probably damaging Het
Cadm2 A T 16: 66,815,347 M109K probably damaging Het
Caskin1 A G 17: 24,505,037 N933S probably damaging Het
Cbln4 T C 2: 172,042,069 N77S possibly damaging Het
Chek1 A G 9: 36,716,473 I256T probably damaging Het
Col5a3 A T 9: 20,793,499 probably benign Het
Cyp2b10 C T 7: 25,917,048 S360L probably benign Het
Dctn1 T C 6: 83,190,220 S222P probably damaging Het
Dnah7b A G 1: 46,124,448 I471V probably benign Het
Ear2 A T 14: 44,102,887 M1L possibly damaging Het
Entpd6 T A 2: 150,764,192 probably benign Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fam98b C T 2: 117,270,639 R311W possibly damaging Het
Ggt7 A T 2: 155,506,427 C102S probably damaging Het
Myo15 T C 11: 60,510,558 probably benign Het
Nlrp9c C T 7: 26,371,277 probably benign Het
Nrxn1 A T 17: 90,163,874 N1234K probably damaging Het
Olfr201 C T 16: 59,268,944 C241Y probably damaging Het
Pcsk1 T C 13: 75,132,119 S688P probably benign Het
Polr1a T C 6: 71,967,916 F1319L probably benign Het
Ppig T C 2: 69,749,459 Y446H unknown Het
Stk17b T C 1: 53,762,599 T88A probably benign Het
Tas2r143 A T 6: 42,400,265 I10F probably benign Het
Theg G A 10: 79,583,850 T182M probably damaging Het
Trpa1 A G 1: 14,891,303 probably null Het
Txndc16 A G 14: 45,172,563 S187P possibly damaging Het
Vmn2r98 T C 17: 19,080,749 I671T possibly damaging Het
Zfp78 G T 7: 6,378,661 V237F probably damaging Het
Other mutations in Tmprss12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02967:Tmprss12 APN 15 100285381 missense probably benign 0.31
IGL03080:Tmprss12 APN 15 100292648 missense probably damaging 1.00
R0497:Tmprss12 UTSW 15 100281039 splice site probably benign
R1800:Tmprss12 UTSW 15 100292547 missense probably benign 0.27
R2096:Tmprss12 UTSW 15 100285236 missense probably benign 0.00
R2851:Tmprss12 UTSW 15 100282415 missense possibly damaging 0.94
R4193:Tmprss12 UTSW 15 100289304 missense probably damaging 1.00
R6498:Tmprss12 UTSW 15 100285252 missense probably damaging 0.99
R6931:Tmprss12 UTSW 15 100285268 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGCTTACAACTTTGTTGTCAGGCTG -3'
(R):5'- ACCAGGGTTCCTACTTGTGCTTGC -3'

Sequencing Primer
(F):5'- TCAGGCTGATATCTAGGGGAAATG -3'
(R):5'- ccctggatctgatccttcaac -3'
Posted On2014-01-05