Mutagenetix > Incidental Mutation

Incidental Mutation 'R1120:Smchd1'

95566

Institutional Source

Beutler Lab

Gene Symbol

Smchd1

Ensembl Gene

ENSMUSG00000024054

Gene Name

SMC hinge domain containing 1

Synonyms

4931400A14Rik, MommeD1

MMRRC Submission

039193-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.842) question?

Stock #

R1120 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

71344489-71475343 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 71358146 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 1847 (Y1847*)

Ref Sequence

ENSEMBL: ENSMUSP00000121835 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000127430]

AlphaFold

Q6P5D8

Predicted Effect

probably null
Transcript: ENSMUST00000127430
AA Change: Y1847*

SMART Domains

Protein: ENSMUSP00000121835
Gene: ENSMUSG00000024054
AA Change: Y1847*

Domain	Start	End	E-Value	Type
Pfam:HATPase_c_3	139	299	6.8e-16	PFAM
low complexity region	451	457	N/A	INTRINSIC
internal_repeat_1	859	1087	9.1e-5	PROSPERO
low complexity region	1185	1196	N/A	INTRINSIC
internal_repeat_1	1205	1409	9.1e-5	PROSPERO
coiled coil region	1649	1680	N/A	INTRINSIC
SMC_hinge	1721	1848	1.64e-15	SMART
low complexity region	1940	1954	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138193

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147111

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180743

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182107

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182205

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 94.2%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a hinge region domain found in members of the SMC (structural maintenance of chromosomes) protein family. [provided by RefSeq, Dec 2011]
PHENOTYPE: Females homozygous for an ENU-induced allele die at midgestation showing placental defects and hypomethylation at X-linked genes that are normally subject to X-inactivation, whereas homozygous males are viable. Females homozygous for a gene trap allele die before E13.5, whereas males remain healthy. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb8	T	G	5: 24,408,820		probably null	Het
Akp3	A	T	1: 87,125,437	Q77L	probably damaging	Het
Blm	A	G	7: 80,481,466	L878S	probably damaging	Het
Cabin1	A	G	10: 75,725,716	Y984H	probably damaging	Het
Cadps2	T	C	6: 23,838,794	Q86R	probably damaging	Het
Cd2	C	T	3: 101,287,488	D95N	probably damaging	Het
Cd36	A	G	5: 17,785,828	I438T	possibly damaging	Het
Crhbp	G	T	13: 95,442,085	T176K	probably benign	Het
D630045J12Rik	G	T	6: 38,194,770	T821K	probably damaging	Het
Disp1	T	C	1: 183,098,575	D288G	probably benign	Het
Dsc3	A	G	18: 19,986,977	V208A	probably benign	Het
Eef1e1	A	T	13: 38,658,934	N20K	probably damaging	Het
Ercc5	A	G	1: 44,161,841	D187G	probably damaging	Het
Etl4	T	A	2: 20,806,703	M1199K	probably benign	Het
Fnbp1	A	T	2: 31,036,594	Y433N	probably damaging	Het
Fxyd3	A	G	7: 31,071,378		probably benign	Het
Hfm1	A	T	5: 106,904,218		probably benign	Het
Irak2	T	A	6: 113,675,759		probably benign	Het
Jpt2	T	C	17: 24,960,611	M1V	probably null	Het
Knl1	A	G	2: 119,062,375	R51G	probably damaging	Het
Krtap8-1	A	G	16: 89,487,865	Y15H	probably benign	Het
Lrba	A	T	3: 86,295,192	D250V	probably damaging	Het
Mgat4a	A	G	1: 37,452,581	S357P	probably damaging	Het
Nup98	T	A	7: 102,160,716	T536S	probably damaging	Het
Olfr1197	A	G	2: 88,728,937	Y221H	probably damaging	Het
Olfr1214	A	G	2: 88,988,079	M41T	possibly damaging	Het
Olfr825	A	G	10: 130,162,537	L263P	probably damaging	Het
Parp14	G	A	16: 35,856,760	A946V	probably benign	Het
Pnpla8	A	G	12: 44,304,947	T568A	possibly damaging	Het
Ptprn	A	G	1: 75,258,181	I254T	probably benign	Het
Rab5b	A	C	10: 128,679,614	N188K	probably benign	Het
Samd5	A	G	10: 9,629,048	V154A	possibly damaging	Het
Smarcb1	A	G	10: 75,921,323	F25L	probably benign	Het
Smpd4	T	C	16: 17,638,486		probably benign	Het
Tex14	T	A	11: 87,538,676		probably benign	Het
Tnfrsf26	G	A	7: 143,617,914	R101C	probably damaging	Het
Trmu	A	G	15: 85,890,285	K37E	possibly damaging	Het
Tsen54	C	T	11: 115,815,013	A52V	probably damaging	Het
Ubb	T	C	11: 62,552,183	I13T	possibly damaging	Het
Vmn2r101	A	T	17: 19,577,461		probably benign	Het

Other mutations in Smchd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Smchd1	APN	17	71465673	splice site	probably benign
IGL00529:Smchd1	APN	17	71394799	missense	probably benign	0.30
IGL00642:Smchd1	APN	17	71390432	missense	probably damaging	1.00
IGL00821:Smchd1	APN	17	71398623	missense	possibly damaging	0.92
IGL01330:Smchd1	APN	17	71436788	missense	probably benign
IGL01432:Smchd1	APN	17	71431290	missense	probably damaging	1.00
IGL01473:Smchd1	APN	17	71389750	missense	probably benign	0.00
IGL01705:Smchd1	APN	17	71381398	missense	probably damaging	1.00
IGL01787:Smchd1	APN	17	71391418	missense	probably damaging	0.99
IGL01814:Smchd1	APN	17	71378187	missense	probably benign	0.01
IGL01976:Smchd1	APN	17	71394725	nonsense	probably null
IGL01995:Smchd1	APN	17	71444020	missense	probably damaging	0.98
IGL02090:Smchd1	APN	17	71431253	missense	possibly damaging	0.86
IGL02302:Smchd1	APN	17	71358133	splice site	probably benign
IGL02309:Smchd1	APN	17	71443903	missense	probably benign	0.32
IGL02391:Smchd1	APN	17	71431259	missense	probably null	1.00
IGL02515:Smchd1	APN	17	71440957	missense	probably damaging	1.00
IGL02644:Smchd1	APN	17	71360021	splice site	probably benign
IGL03081:Smchd1	APN	17	71360191	missense	probably damaging	0.98
IGL03212:Smchd1	APN	17	71443891	missense	probably damaging	0.99
IGL03236:Smchd1	APN	17	71391430	missense	possibly damaging	0.88
IGL03297:Smchd1	APN	17	71349700	missense	probably benign	0.01
Dry_tortugas	UTSW	17	71440956	missense	probably damaging	1.00
R0049:Smchd1	UTSW	17	71431236	missense	probably benign	0.01
R0254:Smchd1	UTSW	17	71411891	missense	probably benign	0.00
R0391:Smchd1	UTSW	17	71403154	missense	probably damaging	1.00
R0403:Smchd1	UTSW	17	71394902	missense	probably damaging	1.00
R0499:Smchd1	UTSW	17	71387088	missense	probably benign
R0520:Smchd1	UTSW	17	71429543	missense	possibly damaging	0.85
R0616:Smchd1	UTSW	17	71379574	missense	probably benign	0.39
R1469:Smchd1	UTSW	17	71349730	missense	probably damaging	1.00
R1469:Smchd1	UTSW	17	71349730	missense	probably damaging	1.00
R1473:Smchd1	UTSW	17	71361837	splice site	probably benign
R1484:Smchd1	UTSW	17	71378257	missense	probably benign	0.31
R1501:Smchd1	UTSW	17	71365094	missense	possibly damaging	0.54
R1718:Smchd1	UTSW	17	71448833	missense	possibly damaging	0.46
R1765:Smchd1	UTSW	17	71400201	splice site	probably benign
R1766:Smchd1	UTSW	17	71391379	missense	probably damaging	0.99
R1803:Smchd1	UTSW	17	71387006	missense	probably damaging	0.99
R1829:Smchd1	UTSW	17	71370337	missense	probably damaging	1.00
R1850:Smchd1	UTSW	17	71389771	missense	probably damaging	0.99
R1917:Smchd1	UTSW	17	71407237	missense	possibly damaging	0.48
R1918:Smchd1	UTSW	17	71407237	missense	possibly damaging	0.48
R1936:Smchd1	UTSW	17	71463791	missense	probably damaging	1.00
R2024:Smchd1	UTSW	17	71370928	missense	probably benign	0.15
R2147:Smchd1	UTSW	17	71398588	missense	possibly damaging	0.93
R2180:Smchd1	UTSW	17	71463799	missense	probably benign	0.23
R2398:Smchd1	UTSW	17	71360141	missense	probably damaging	1.00
R2398:Smchd1	UTSW	17	71426436	splice site	probably benign
R2935:Smchd1	UTSW	17	71411905	missense	probably damaging	1.00
R3000:Smchd1	UTSW	17	71363038	missense	probably benign	0.00
R3021:Smchd1	UTSW	17	71387098	missense	possibly damaging	0.75
R3808:Smchd1	UTSW	17	71429541	missense	probably damaging	1.00
R4323:Smchd1	UTSW	17	71428275	missense	probably benign	0.00
R4486:Smchd1	UTSW	17	71407235	missense	probably benign	0.02
R4487:Smchd1	UTSW	17	71407235	missense	probably benign	0.02
R4488:Smchd1	UTSW	17	71407235	missense	probably benign	0.02
R4489:Smchd1	UTSW	17	71407235	missense	probably benign	0.02
R4723:Smchd1	UTSW	17	71436747	nonsense	probably null
R4751:Smchd1	UTSW	17	71391468	missense	probably benign	0.01
R4798:Smchd1	UTSW	17	71360053	nonsense	probably null
R4814:Smchd1	UTSW	17	71411768	critical splice donor site	probably null
R4882:Smchd1	UTSW	17	71358239	intron	probably benign
R5088:Smchd1	UTSW	17	71431348	missense	possibly damaging	0.86
R5589:Smchd1	UTSW	17	71440961	missense	probably damaging	1.00
R5618:Smchd1	UTSW	17	71455727	missense	probably damaging	1.00
R5839:Smchd1	UTSW	17	71394862	missense	probably damaging	0.98
R5994:Smchd1	UTSW	17	71365409	missense	possibly damaging	0.89
R6009:Smchd1	UTSW	17	71440956	missense	probably damaging	1.00
R6042:Smchd1	UTSW	17	71377057	nonsense	probably null
R6082:Smchd1	UTSW	17	71349719	missense	probably benign	0.09
R6126:Smchd1	UTSW	17	71370285	missense	probably damaging	1.00
R6294:Smchd1	UTSW	17	71370927	missense	probably benign	0.13
R6788:Smchd1	UTSW	17	71475101	missense	probably benign	0.02
R6853:Smchd1	UTSW	17	71436743	missense	probably damaging	1.00
R6875:Smchd1	UTSW	17	71353506	missense	probably damaging	1.00
R7026:Smchd1	UTSW	17	71349667	missense	probably benign
R7045:Smchd1	UTSW	17	71415044	missense	probably benign	0.22
R7068:Smchd1	UTSW	17	71387092	missense	probably benign	0.00
R7085:Smchd1	UTSW	17	71365219	splice site	probably null
R7089:Smchd1	UTSW	17	71361960	missense	probably benign	0.00
R7145:Smchd1	UTSW	17	71378207	missense	probably benign
R7158:Smchd1	UTSW	17	71400150	missense	probably damaging	0.99
R7180:Smchd1	UTSW	17	71394823	missense	probably damaging	0.99
R7183:Smchd1	UTSW	17	71353516	missense	probably benign	0.00
R7214:Smchd1	UTSW	17	71345364	missense	probably benign	0.15
R7414:Smchd1	UTSW	17	71475079	missense	probably damaging	0.99
R7512:Smchd1	UTSW	17	71381369	missense	possibly damaging	0.51
R7631:Smchd1	UTSW	17	71398689	missense	probably benign	0.10
R7641:Smchd1	UTSW	17	71390479	missense	probably benign	0.00
R7709:Smchd1	UTSW	17	71358198	missense	probably damaging	1.00
R7768:Smchd1	UTSW	17	71411911	missense	probably damaging	1.00
R7789:Smchd1	UTSW	17	71475301	start gained	probably benign
R7898:Smchd1	UTSW	17	71377818	splice site	probably null
R7965:Smchd1	UTSW	17	71455626	missense	possibly damaging	0.65
R8177:Smchd1	UTSW	17	71390453	missense	probably benign	0.28
R8359:Smchd1	UTSW	17	71431243	missense	probably damaging	0.99
R8370:Smchd1	UTSW	17	71394913	missense	probably benign	0.22
R8426:Smchd1	UTSW	17	71448603	missense	probably damaging	1.00
R8443:Smchd1	UTSW	17	71407249	missense	probably benign	0.18
R8948:Smchd1	UTSW	17	71436772	missense	probably damaging	1.00
R8954:Smchd1	UTSW	17	71448757	missense	probably damaging	1.00
R9041:Smchd1	UTSW	17	71394715	critical splice donor site	probably null
R9054:Smchd1	UTSW	17	71363022	nonsense	probably null
R9141:Smchd1	UTSW	17	71365130	missense	probably benign	0.00
R9169:Smchd1	UTSW	17	71415664	missense	probably damaging	1.00
R9231:Smchd1	UTSW	17	71365089	missense	probably benign	0.05
R9368:Smchd1	UTSW	17	71387076	missense	probably damaging	1.00
R9374:Smchd1	UTSW	17	71411848	missense	possibly damaging	0.61
R9416:Smchd1	UTSW	17	71394796	missense	probably benign	0.27
R9426:Smchd1	UTSW	17	71365130	missense	probably benign	0.00
R9491:Smchd1	UTSW	17	71360025	critical splice donor site	probably null
R9511:Smchd1	UTSW	17	71443904	missense	possibly damaging	0.65
R9591:Smchd1	UTSW	17	71394833	missense	probably damaging	1.00
R9593:Smchd1	UTSW	17	71394833	missense	probably damaging	1.00
Z1176:Smchd1	UTSW	17	71361841	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- CCAGCGGCTCTTCTAACTGAGAAC -3'
(R):5'- TGGAAATCCAGTCTTTGCCCGAG -3'

Sequencing Primer
(F):5'- GGCTCTTCTAACTGAGAACTCACTG -3'
(R):5'- CAGTCTTTGCCCGAGATTTG -3'

Posted On

2014-01-05