Incidental Mutation 'R1035:Olfr201'
ID95571
Institutional Source Beutler Lab
Gene Symbol Olfr201
Ensembl Gene ENSMUSG00000074995
Gene Nameolfactory receptor 201
SynonymsGA_x54KRFPKG5P-55483936-55483010, MOR182-2
MMRRC Submission 039134-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R1035 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location59266113-59272632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 59268944 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 241 (C241Y)
Ref Sequence ENSEMBL: ENSMUSP00000150660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099656] [ENSMUST00000216834]
Predicted Effect probably damaging
Transcript: ENSMUST00000099656
AA Change: C241Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097248
Gene: ENSMUSG00000074995
AA Change: C241Y

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.2e-46 PFAM
Pfam:7tm_1 41 290 8e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216834
AA Change: C241Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.4%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Ap3b2 A T 7: 81,463,911 L850Q unknown Het
Asxl3 T C 18: 22,525,049 S2039P probably damaging Het
Cadm2 A T 16: 66,815,347 M109K probably damaging Het
Caskin1 A G 17: 24,505,037 N933S probably damaging Het
Cbln4 T C 2: 172,042,069 N77S possibly damaging Het
Chek1 A G 9: 36,716,473 I256T probably damaging Het
Col5a3 A T 9: 20,793,499 probably benign Het
Cyp2b10 C T 7: 25,917,048 S360L probably benign Het
Dctn1 T C 6: 83,190,220 S222P probably damaging Het
Dnah7b A G 1: 46,124,448 I471V probably benign Het
Ear2 A T 14: 44,102,887 M1L possibly damaging Het
Entpd6 T A 2: 150,764,192 probably benign Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fam98b C T 2: 117,270,639 R311W possibly damaging Het
Ggt7 A T 2: 155,506,427 C102S probably damaging Het
Myo15 T C 11: 60,510,558 probably benign Het
Nlrp9c C T 7: 26,371,277 probably benign Het
Nrxn1 A T 17: 90,163,874 N1234K probably damaging Het
Pcsk1 T C 13: 75,132,119 S688P probably benign Het
Polr1a T C 6: 71,967,916 F1319L probably benign Het
Ppig T C 2: 69,749,459 Y446H unknown Het
Stk17b T C 1: 53,762,599 T88A probably benign Het
Tas2r143 A T 6: 42,400,265 I10F probably benign Het
Theg G A 10: 79,583,850 T182M probably damaging Het
Tmprss12 G A 15: 100,285,200 R141Q probably benign Het
Trpa1 A G 1: 14,891,303 probably null Het
Txndc16 A G 14: 45,172,563 S187P possibly damaging Het
Vmn2r98 T C 17: 19,080,749 I671T possibly damaging Het
Zfp78 G T 7: 6,378,661 V237F probably damaging Het
Other mutations in Olfr201
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01734:Olfr201 APN 16 59268850 missense probably benign 0.07
IGL01985:Olfr201 APN 16 59269079 missense probably benign
IGL02618:Olfr201 APN 16 59268927 missense probably damaging 1.00
IGL02830:Olfr201 APN 16 59269053 missense possibly damaging 0.94
PIT4449001:Olfr201 UTSW 16 59269130 missense probably damaging 1.00
R0047:Olfr201 UTSW 16 59269211 missense probably damaging 1.00
R0047:Olfr201 UTSW 16 59269211 missense probably damaging 1.00
R1037:Olfr201 UTSW 16 59268944 missense probably damaging 1.00
R1163:Olfr201 UTSW 16 59269155 missense probably benign 0.23
R1225:Olfr201 UTSW 16 59269224 missense probably benign
R1519:Olfr201 UTSW 16 59268944 missense probably damaging 1.00
R1583:Olfr201 UTSW 16 59269031 missense probably benign 0.00
R2075:Olfr201 UTSW 16 59268911 missense possibly damaging 0.60
R4591:Olfr201 UTSW 16 59269413 missense possibly damaging 0.94
R5547:Olfr201 UTSW 16 59269116 missense probably benign 0.35
R6132:Olfr201 UTSW 16 59269004 missense probably damaging 0.97
R6737:Olfr201 UTSW 16 59268812 missense possibly damaging 0.60
R6872:Olfr201 UTSW 16 59269598 missense probably benign 0.20
R8001:Olfr201 UTSW 16 59269109 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTGCTACAAGAACTTCACTGAACCC -3'
(R):5'- CTTGGTGTTCTGCACTTGGCAATTC -3'

Sequencing Primer
(F):5'- GAGGATACTGACCCTCCAGTAAAATG -3'
(R):5'- GTTTGTTACTTAGACTGACTTTCTGC -3'
Posted On2014-01-05